
Human Anatomy & Physiology
1st Edition
ISBN: 9780805382952
Author: Erin C. Amerman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 7.5, Problem 6QC
Summary Introduction
To review:
The seven tarsal bones.
Introduction:
The ankle is composed of the seven tiny bones that are known as tarsals, and these join the leg with the foot. Four of these form the distal tarsal bone and three comprises the proximal tarsal bones
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 7 Solutions
Human Anatomy & Physiology
Ch. 7.1 - 1. Which parts of the skeleton belong to the...Ch. 7.1 - Where are skeletal cartilages located?Ch. 7.1 - 3. What are some functions of bone markings?
Ch. 7.2 - 1. Match each bone with the correct description...Ch. 7.2 - 2. Which bones form the orbit?
Ch. 7.2 - 3. What are the paranasal sinuses, and how are...Ch. 7.2 - 4. How are the oral and nasal cavities related...Ch. 7.2 - What are fontanels, and why are they important in...Ch. 7.2 - Where are the six main fontanels located?Ch. 7.2 - What is unique about the hyoid bone?
Ch. 7.3 - 1. How many cervical, thoracic, lumbar, sacral,...Ch. 7.3 - Prob. 2QCCh. 7.3 - Compare scoliosis, lordosis, and kyphosis.Ch. 7.3 - How do the atlas and axis differ from other...Ch. 7.3 - Identify each of the following characteristics as...Ch. 7.3 - 6. Describe the structure of an intervertebral...Ch. 7.3 - 7. What are the three components of the sternum?
Ch. 7.3 - How do true, false, and floating ribs differ?Ch. 7.4 - With which structures does the clavicle...Ch. 7.4 - 2. What are the glenoid cavity, acromion, and...Ch. 7.4 - 3. With which structures does the humerus...Ch. 7.4 - Describe the structure and location of the...Ch. 7.4 - 5. How do the radius and ulna differ in their...Ch. 7.4 - Which parts of the radius and ulna articulate with...Ch. 7.4 - With what other bones do the radius and ulna...Ch. 7.4 - 8. List the proximal and distal carpal bones from...Ch. 7.4 - 9. How many metacarpals and phalanges are in the...Ch. 7.4 - 10. What are the three parts of a metacarpal and...Ch. 7.5 - With which bones does the femur articulate? Be...Ch. 7.5 - Which parts of the femur form these articulations?Ch. 7.5 - Prob. 3QCCh. 7.5 - 4. With which bones does the tibia articulate?...Ch. 7.5 - 5. What are the bony projections of the medial...Ch. 7.5 - Prob. 6QCCh. 7.5 - How does the structure of the foot and toes...Ch. 7.5 - 8. What are the three arches of the foot?
Ch. 7 - 1. Which of the following are considered parts of...Ch. 7 - 2. ________is the anatomical name for a hole in a...Ch. 7 - Fill in the blanks: The two parietal bones are...Ch. 7 - Mark the following statements as true or false. If...Ch. 7 - The only moveable bone in the adult skull is the:...Ch. 7 - 6. The structure(s) that divide the nasal cavity...Ch. 7 - The soft spots in an infants skull are known as:...Ch. 7 - 8. Mark the following statements as true or...Ch. 7 - 9. Transverse foramina are a characteristic of...Ch. 7 - Fill in the blanks: The inferior portion of the...Ch. 7 - How do true, false, and floating ribs differ from...Ch. 7 - Which of the following portions of the scapula...Ch. 7 - Fill in the blanks: The only bone of the arm is...Ch. 7 - The elbow bone is called the: a. trochlea. b....Ch. 7 - Which of the following is not a proximal carpal...Ch. 7 - Mark the following statements as true or false. If...Ch. 7 - 17. The most lateral projection of the proximal...Ch. 7 - 18. Fill in the blanks: The bones of the leg are...Ch. 7 - 19. The heel bone is more properly known as...Ch. 7 - The arch(es) of the foot are the: a. transverse...Ch. 7 - How do the atlas (C1) and the axis (C2) differ...Ch. 7 - Explain how abnormal bone structure could affect...Ch. 7 - What structures form the knee and elbow joints? Of...Ch. 7 - A deviated septum results when the nasal septum is...Ch. 7 - Mrs. Dent presents to the clinic with back pain....Ch. 7 - You arrive on the scene where a person without a...Ch. 7 - Predict where each of the following structures is...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Fundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage LearningMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Fundamentals of Sectional Anatomy: An Imaging App...
Biology
ISBN:9781133960867
Author:Denise L. Lazo
Publisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
The Skeletal System; Author: Professor Dave Explains;https://www.youtube.com/watch?v=f-FF7Qigd3U;License: Standard YouTube License, CC-BY