a.
To describe:
The reason why red blood cells were not seen in the sample where they were suspended in sterile water.
Concept introduction:
Osmosis occurs when water is transported by fluids across a semi-permeable membrane down the concentration gradient. This process takes place in accordance with temperature, and pressure. If the concentration of solute and free water molecules is same, the solution is isotonic and doesn’t involve any movement of water across the semi-permeable membrane. When a solution with varying concentrations is divided by a semi-permeable membrane, a solution that contains higher concentration is calledit as a hypertonic solution and that is more diluted is called isotonic solution.
b.
To describe:
The consequence of suspending bacterial cells in sterile water.
Concept introduction:
If the concentration of solute and free water molecules is same, the solution is isotonic, and it does not involve any movement of water across the cell membrane by osmosis. When a solution with varying concentrations is divided by a membrane, the area with higher concentration is the hypertonic solution and the area which is more diluted is called as the isotonic solution. Osmosis always occurs down the concentration gradient (from low concentration to high concentration).

Want to see the full answer?
Check out a sample textbook solution
Chapter 7 Solutions
MICROBIOLOGY W/ACCESS
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage LearningComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning



