Concept explainers
Concept introduction:
Biofilms are the colonies formed by different species of bacteria. These colonies are initiated by one bacterium that attaches to the surface of vulnerable body parts, likea tooth or lung tissue. The other microbes subsequently attach to either the first bacterium or the inevitable sugar and protein secretions by it.
Biofilms are present in almost every natural environment, and it is an adaptation strategy of bacteria for the sustenance of their lives. The different species of bacteria cooperate and interact with each other while forming biofilms, and functioning in these colonies.
Biofilms are also involved inthe passing of genetic material from one microbe to its neighboring microbe. Therefore, they can cause infections and also develops resistance to antimicrobials.

Want to see the full answer?
Check out a sample textbook solution
Chapter 7 Solutions
MICROBIOLOGY W/ACCESS
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningEssentials Health Info Management Principles/Prac...Health & NutritionISBN:9780357191651Author:BowiePublisher:Cengage
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax

