Genetic Analysis: An Integrated Approach (2nd Edition)
Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 7, Problem 28P

In a dideoxy DNA sequencing experiment, four separate reactions are carried out to provide the replicated material for DNA sequencing gels. Reaction products are usually run in gel lanes labeled A,T,C, and G.

Identify the nucleotides used in the dideoxy DNA sequencing reaction that produces molecules for the A lane of the sequencing gel.

a. How does PCR play a role in dideoxy DNA sequencing?

b. Why is incorporation of a dideoxynucleotide during DNA sequencing identified as a “replication-terminating” event?

Blurred answer
Students have asked these similar questions
You are trying to clone a gene, You have successfully isolated it from the genomic DNA of an organism using the Hindill restriction enzyme. You then take a plasmid with a single EcoRI restriction site and cleave it with EcoRI. You combine these two fragments and treat them with DNA ligase. Answer the two questions below. a. Does the cloning reaction succeed as described? If so, what is the product obtained? b. Explain your answer above,
A. A plasmid is shown with the locations of various restriction enzyme sites labeled. If you cut the plasmid with Xhol and Xbal, which lane of the agarose gel represents the DNA fragments you would expect from the digestion? B. If you now decide to cut the plasmid with EcoRI, how many fragments will be produced and what will their sizes be? C. When running DNA samples on agarose gel, an electric field is applied. Towards which electrode will the DNA migrate and why?
A researcher is interested in using the in vitro technique of bisulfite conversion to confirm the methylation status of a DNA sequence. A. In vitro Sodium bisulfite treatment of DNA results in what type of chemical reaction? i. Which bases are preferentially affected? B. What nucleotide change is expected immediately following sodium bisulfite treatment of the DNA? C. You analyze the following DNA sequence before bisulfite treatment and after bisulfite treatment followed by a 30-cycle PCR reaction. Based on sequence comparison, how many cytosines were unmethylated in the original DNA sequence? Briefly explain how you came to this conclusion. Before bisulfite treatment: After bisulfite treatment and a 30-cycle PCR reaction: 5' CGACGCGCGATTCATTCGATT 3' 5' TGACGCGTGATTTATTTGATT 3'

Chapter 7 Solutions

Genetic Analysis: An Integrated Approach (2nd Edition)

Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license