![Genetic Analysis: An Integrated Approach (2nd Edition)](https://www.bartleby.com/isbn_cover_images/9780321948908/9780321948908_largeCoverImage.gif)
Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 7, Problem 28P
In a dideoxy DNA sequencing experiment, four separate reactions are carried out to provide the replicated material for DNA sequencing gels. Reaction products are usually run in gel lanes labeled A,T,C, and G.
Identify the
a. How does PCR play a role in dideoxy DNA sequencing?
b. Why is incorporation of a dideoxynucleotide during DNA sequencing identified as a “replication-terminating” event?
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
You are trying to clone a gene, You have successfully isolated it from the genomic DNA of an organism using the Hindill restriction enzyme. You then take a
plasmid with a single EcoRI restriction site and cleave it with EcoRI. You combine these two fragments and treat them with DNA ligase. Answer the two questions
below.
a. Does the cloning reaction succeed as described? If so, what is the product obtained?
b. Explain your answer above,
A. A plasmid is shown with the locations of various restriction enzyme sites labeled. If you cut the plasmid with Xhol and Xbal, which lane of the agarose gel represents the DNA fragments you would expect from the digestion?
B. If you now decide to cut the plasmid with EcoRI, how many fragments will be produced and what will their sizes be?
C. When running DNA samples on agarose gel, an electric field is applied. Towards which electrode will the DNA migrate and why?
A researcher is interested in using the in vitro technique of bisulfite conversion to confirm the
methylation status of a DNA sequence.
A. In vitro Sodium bisulfite treatment of DNA results in what type of chemical reaction?
i. Which bases are preferentially affected?
B. What nucleotide change is expected immediately following sodium bisulfite treatment
of the DNA?
C. You analyze the following DNA sequence before bisulfite treatment and after bisulfite
treatment followed by a 30-cycle PCR reaction. Based on sequence comparison, how
many cytosines were unmethylated in the original DNA sequence? Briefly explain how
you came to this conclusion.
Before bisulfite treatment:
After bisulfite treatment and a 30-cycle PCR reaction:
5' CGACGCGCGATTCATTCGATT 3'
5' TGACGCGTGATTTATTTGATT 3'
Chapter 7 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
Ch. 7 - What results from the experiments of Frederick...Ch. 7 - 7.2 Explain why Avery, MacLeod, and McCarty’s in...Ch. 7 - 7.3 Hershey and Chase selected the bacteriophage...Ch. 7 - 7.4 Explain how the Hershey and Chase experiment...Ch. 7 - 7.5 One strand of a fragment of duplex DNA has the...Ch. 7 - 7.6 The principles of complementary base pairing...Ch. 7 - For the following fragment of DNA, determine the...Ch. 7 - 7.8 Figures present simplified depictions of...Ch. 7 - 7.9 Consider the sequence -ACGCTACGTC-.
What is...Ch. 7 - DNA polymerase III is the main DNA-synthesizing...
Ch. 7 - Explain how RNA participates in DNA replication.Ch. 7 - A sample of double-stranded DNA is found to...Ch. 7 - Bacterial DNA polymerase I and DNA polymerase III...Ch. 7 - Diagram a replication fork in bacterial DNA and...Ch. 7 - Prob. 16PCh. 7 - Which of the following equalities is not true for...Ch. 7 - List the order in which the following proteins and...Ch. 7 - Two viral genomes are sequenced, and the following...Ch. 7 - Matthew Meselson and Franklin Stahl demonstrated...Ch. 7 - Raymond Rodriguez and colleagues demonstrated...Ch. 7 - 7.22 Joel Huberman and Arthur Riggs used pulse...Ch. 7 - 7.23 Why do the genomes of eukaryotes, such as...Ch. 7 - Bloom syndrome (OMIM 210900) is an autosomal...Ch. 7 - 7.25 How does rolling circle replication (see...Ch. 7 - Telomeres are found at the ends of eukaryotic...Ch. 7 - A family consisting of a mother (I-1), a father...Ch. 7 - In a dideoxy DNA sequencing experiment, four...Ch. 7 - Prob. 29PCh. 7 - Using an illustration style and labeling similar...Ch. 7 - A PCR reaction begins with one double-stranded...Ch. 7 - Prob. 32PCh. 7 - Three independently assorting VNTR markers are...Ch. 7 - 7.34 A sufficient amount of a small DNA fragment...Ch. 7 - Prob. 35P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Describe the possible outcome of a PCR experiment in which (a) there is a single-stranded break in the target DNA sequence, which is present in only one copy in the starting sample, and (b) there is a doublestranded break in the target DNA sequence, which is present in only one copy in the starting sample.arrow_forwardOn the gel shown below are four DNA samples. Samples A to C are taken from tissues of landslide victims that are being identified, while sample D came from a hair sample brought by a mother looking for the remains of her son. (see img) i. If similar band patterns in a gel are created using the same restriction enzyme, what does that tell you about the DNA sequence of the samples? ii. In sample C, only two fragments were created. How many restriction sites (regions where enzymes cut) are present in sample C?arrow_forwardExplain why DNA ladders are usually included during gel electrophoresis. One aspect of PCR that can be modified is the annealing temperature. In general, higher annealing temperatures show more specificity towards a single template, whereas lower annealing temperatures show less specificity and may bind to multiple regions throughout the genome. Discuss how using an annealing temperature that is too high or too low might influence the results of a PCR assay (and gel electrophoresis results) such as the one used in this study.arrow_forward
- PCR is a molecular biology technique where template DNA is amplified using a primer and oligonucleotides. The reaction is catalyzed by a thermostable DNA polymerase and in a particular reaction, the template strands are denatured at 95˚C. For strand hybridization, the melting temperature is 55˚C. What do you predict about the average duration of H bonds at the high temperature in comparison to the low temperature?arrow_forwardExamine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TTGCATCG 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA, and will this primer work as part of a pair to successfully amplify this fragment of DNA? 5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA 3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT a. It will bind to the bottom strand on the left side of the fragment, and is suitable to amplify the fragment by PCR. b. It will bind to the top strand on the left side of the fragment, but it is unsuitable to amplify the fragment by PCR. c. It will bind to the top strand on the right side of the fragment, but it is unsuitable to amplify the fragment by PCR. d. It will bind to the bottom strand on the right side of the…arrow_forwardYou used agarose gel electrophoresis to separate DNA fragments of different size and the experiment worked well. However, you wanted to re run the experiment but this time you made the gel with a higher percentage of Agarose. How might this affect your results compared to the first run? a. There would be no difference between the runs since it is the current, not the agarose that causes migration. b. The higher concentration of agarose would cause the DNA to break apart. c. You can't predict how the concetration of agarose would affect migration. d. The DNA fragments would migrate further down the gel than they did the first time. e. The DNA fragments wouldn't migrate as far down the gel as they did the first time.arrow_forward
- The figure below shows the recognition sequences and cleavage positions of three restriction enzymes.You plan to ligate DNA from two different sources. The target DNA is digested with BamHI,and the insert DNA is digested with BglII, and the resulting fragments mixed and incubatedwith DNA ligase. a) Write out the sequence (in double-stranded format) of the longest insert fragment that will result after BglII digestion, ensure the nature of the overhangs is clear.b) Write out the sequence (in double-stranded format) of the ligation product, with the insert fragment joined into the BamHI site of the target DNA. Use black for target sequences, and blue for insert sequences. c) Assume the ligation reaction was successful and you have generated a recombinant DNAmolecule. Which of the three enzymes listed above can be used to excise the insert DNAfrom the target? Motivate your answer.arrow_forwardTranscriptome analysis involves two separate methodologies: gene expression and RNA seq analyses. The 10 items below are a scrambled listing of the steps used in the two procedures. Identify the steps involved in RNA seq from the list below. Use the numbers in the list to refer to each step. Once the steps for RNA seq have been identified, write the steps in the order in which they are performed during the experiment. (1) DNA sequencing (2) Allow for hybridization and wash excess cRNA. (3) Mix labeled cRNA with array chip. (4) PCR amplification (5) Measure fluorescence intensity to determine abundance of transcripts. (6) Add labeled cRNA at each microarray location. (7) Map cDNA sequences to the genome of the organism to determine identity and abundance of transcripts. (8) mRNA isolation from cells (9) Prepare fluorescently labeled cRNA probes (10) cDNA synthesisarrow_forwardPlease explainarrow_forward
- You are setting up your PCR reaction and accidentally add twice as much of the salt buffer as you were supposed to. Select all that apply. 1. How will this impact product formation? 2. In what way(s) will the reaction be altered? (a) ...because primer/template binding will be altered (b) ...because the mechanism of dNTP addition will be altered. (c) You will get more of the desired PCR product... (d) ...because template denaturation will be altered. (e) You will get the same amount of the desired PCR product... (f) You will get less of the desired PCR product...arrow_forwardDescribe the possible outcome of a PCR experiment in which (a) one of the primers is inadvertently omitted from the reaction mixture and (b) one of the primers is complementary to several sites in the starting DNA sample.arrow_forwardRestriction endonuclease digestion of a DNA sequence yielded fragments of the following sizes: 1. 5.2 kb 2. 0.8 kb 3. 1.2 kb 4. 3.8 kb 5. 3.1 kb After gel electrophoresis, what would be the order in which these fragments would be found—the last fragment listed being furthest from the negative pole.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license