Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 7, Problem 19P
Two viral genomes are sequenced, and the following percentages of
Genome
Genome
Are the DNA molecules in each genome single- stranded or double-stranded?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Figure 3: Restrictrion site map showing the following: A) linear DNA that is not cut as reference B) DNA cut with BamHI, C) DNA cut with
EcoRI, D) DNA cut with Hindlll
1. Calculate the size of the resulting fragments as they will occur after digestion and write
the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp
A
A DNA
10,000
20,000
30,000
40,000
48,502 (bp)
The principal genomic component isolated from equine influenza virus is 22% C, 23% A, 22% G and 33% U. Is this sufficient data to determine whether the genomic material is DNA/RNA and is double- or single-stranded? Why or why not? Explain, using a diagram
Assume you isolate a single stranded (+) RNA virus. When you examine the proteins in the virus, you find that it does NOT contain replicase enzymes within its capsid. Which of the following is true?
This virus must have a gene that encodes replicase.
This virus will not be able to enter a host cell.
Its genome cannot be translated (the process of translation) by the host cell ribosomes.
A DNA copy of the viral genome has to be made before viral genes are expressed.
This virus must lack surface antigens.
Chapter 7 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
Ch. 7 - What results from the experiments of Frederick...Ch. 7 - 7.2 Explain why Avery, MacLeod, and McCarty’s in...Ch. 7 - 7.3 Hershey and Chase selected the bacteriophage...Ch. 7 - 7.4 Explain how the Hershey and Chase experiment...Ch. 7 - 7.5 One strand of a fragment of duplex DNA has the...Ch. 7 - 7.6 The principles of complementary base pairing...Ch. 7 - For the following fragment of DNA, determine the...Ch. 7 - 7.8 Figures present simplified depictions of...Ch. 7 - 7.9 Consider the sequence -ACGCTACGTC-.
What is...Ch. 7 - DNA polymerase III is the main DNA-synthesizing...
Ch. 7 - Explain how RNA participates in DNA replication.Ch. 7 - A sample of double-stranded DNA is found to...Ch. 7 - Bacterial DNA polymerase I and DNA polymerase III...Ch. 7 - Diagram a replication fork in bacterial DNA and...Ch. 7 - Prob. 16PCh. 7 - Which of the following equalities is not true for...Ch. 7 - List the order in which the following proteins and...Ch. 7 - Two viral genomes are sequenced, and the following...Ch. 7 - Matthew Meselson and Franklin Stahl demonstrated...Ch. 7 - Raymond Rodriguez and colleagues demonstrated...Ch. 7 - 7.22 Joel Huberman and Arthur Riggs used pulse...Ch. 7 - 7.23 Why do the genomes of eukaryotes, such as...Ch. 7 - Bloom syndrome (OMIM 210900) is an autosomal...Ch. 7 - 7.25 How does rolling circle replication (see...Ch. 7 - Telomeres are found at the ends of eukaryotic...Ch. 7 - A family consisting of a mother (I-1), a father...Ch. 7 - In a dideoxy DNA sequencing experiment, four...Ch. 7 - Prob. 29PCh. 7 - Using an illustration style and labeling similar...Ch. 7 - A PCR reaction begins with one double-stranded...Ch. 7 - Prob. 32PCh. 7 - Three independently assorting VNTR markers are...Ch. 7 - 7.34 A sufficient amount of a small DNA fragment...Ch. 7 - Prob. 35P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The DNA sequence of the genome of a virus is known and contains equal number of A, TG and C. The genome is composed of double stranded DNA molecule. It is 10Kb in length. If one searches the genome for the presence of the following sequence 5'-AAAAAA-3'/3'-TTTTTT-5', predict the number of such stretches that are likely to occur. (1Kb = 1000 base pairs). a) Two b) Eight c) Sixteen d) Thirty twoarrow_forwardThe sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forward40) The molecular forces that hold the proteins of a capsule together are covalent bonds. True or false 41)The first successful gene therapy using a viral vector was to correct an enzyme deficiency (adenosine deaminase) in a girl. The virus used was adenovirus. True or false 50) How many chromatids are there in a chromosome at the end of G1? a) 1 b) 8 c) 4 d) 2arrow_forward
- You are studying RNA viruses and have discovered one that grows well in a culture of eukaryotic cells. You know that the virus is a single-stranded RNA virus, but you don't know if it is positive or negative stranded. Your lab-mate says, "Well, just treat your cell culture with cyclohexamide and see if the virus replicates its genome." You know that cyclohexamide inhibits protein elongation by binding to eukaryotic ribosomes. What is the basis of your lab-mate's suggestion?arrow_forwardChemical composition analysis of a viral genome showed 22.1% A, 27.9% C, 27.9% G, and 22.1% U. Based on this, the viral genome is most likely made of: a) single-stranded (ss) DNA b) double-stranded (ds) DNA c) SSRNA d) dsRNA e) plasmid DNAarrow_forwardTo test patients for COVID19, lab workers will first convert all the RNA molecules extracted from a nasal swab to a double-stranded DNA copy (dsDNA). If the virus is present, its genomic sequence should be in some of the new dsDNA molecules. Part 1) A region of COVID genomic DNA sequence is shown below. Following convention, only the top strand is shown. Copy/paste the sequence into the text box and create the second strand. Be sure to label its ends. (You may need to reduce the font size so that it doesn't wrap around) AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTC Part 2) To test for the presence of COVID DNA sequence, lab workers use single-stranded DNA oligonucleotides as probes (short pieces of DNA that do not have a partner strand). If the two strands of DNA that you drew were separated from each other, where would the shorter DNA strand shown below be able to form continuous base pairs? Highlight that region in your dsDNA model. TGTAGCACGATTGCAGCATTG Note: If you…arrow_forward
- Which biological system contains a protein nucleocapsid surrounding 2 antiparallel polynucleotide strands (held together by hydrogen bonds), with deoxyribose sugars, but no ribose sugars? a single-stranded RNA viroid (like avocado sun blotch viroid) a double-stranded RNA virus (like the reovirus family) a single-stranded DNA virus (like fX174 virus of E. coli) a double-stranded DNA virus (like the smallpox virus) a single-stranded RNA virus (like tobacco mosaic virus)arrow_forwardA single DNA molecule contains two specific target sites separated by an intervening sequence. If site-specific recombination between these sites causes the intervening sequence to be released as a separate circular DNA molecule containing one target site, then the sites were oriented in A) opposite directions causing excision. B) the same direction causing excision. C) opposite directions causing integration. D) the same direction causing integration. E) the same direction causing inversion.arrow_forwardWhich of the following statements about DNA polymerase I are true? 1) It requires both template DNA and a primer. 2) It can copy and join the ends of single-stranded circular DNA. 3) It uses only DNA as a template primer. 4) With respect to linear DNA, it copies only the 5′ end and then dissociates. a) Only statements 1 and 3 are true. b) Only statements 1 and 4 are true. c) Only statements 1, 2, and 4 are true. d) All of the listed statements are true.arrow_forward
- A particular animal virus requires the use of DNA polymerase from its host, since it does not possess its own DNA polymerase enzyme. Which of the following assumptions in A-D would likely be correct regarding this virus? A) O This virus could not be a retrovirus type. B) OIt could be a (-) ss RNA virus. C) O It could be a (+) ss RNA virus. D) O The vVirus life cycle very likely includes going to the host cell nucleus. E) O All ofA-D are correct assumptions.arrow_forwardWhich of the following statements is false? a) the bacterial chromosome is usually circular b) the bacterial chromosome has a single origin of replication c) the bacterial chromosome consists of a single molecule of DNA d) plasmids are small DNA molecules that occur in bacteria but are not essential - for normal function. e) Most bacterial genomes consist of fewer than 1,000 genesarrow_forwardTo study the interaction between viral proteins and Z-DNA, how could Z-DNA-forming DNA be synthesized in the lab?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY