Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 7, Problem 23P
Why do the genomes of eukaryotes, such as Drosophila, need to have multiple origins of replication, whereas bacterial genomes, such as that of E. coli, have only a single origin?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
If the rate of replication in a particular prokaryote is 900 nucleotides per second, how long would it take 1.2 million base pair genomes to make two copies?
Considering prokaryotes, what term adds nucleotides in the 5' to 3' direction during DNA replication?
In what ways does chromosomal replication in eukaryotes differ from DNA replication in prokaryotes?
Chapter 7 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
Ch. 7 - What results from the experiments of Frederick...Ch. 7 - 7.2 Explain why Avery, MacLeod, and McCarty’s in...Ch. 7 - 7.3 Hershey and Chase selected the bacteriophage...Ch. 7 - 7.4 Explain how the Hershey and Chase experiment...Ch. 7 - 7.5 One strand of a fragment of duplex DNA has the...Ch. 7 - 7.6 The principles of complementary base pairing...Ch. 7 - For the following fragment of DNA, determine the...Ch. 7 - 7.8 Figures present simplified depictions of...Ch. 7 - 7.9 Consider the sequence -ACGCTACGTC-.
What is...Ch. 7 - DNA polymerase III is the main DNA-synthesizing...
Ch. 7 - Explain how RNA participates in DNA replication.Ch. 7 - A sample of double-stranded DNA is found to...Ch. 7 - Bacterial DNA polymerase I and DNA polymerase III...Ch. 7 - Diagram a replication fork in bacterial DNA and...Ch. 7 - Prob. 16PCh. 7 - Which of the following equalities is not true for...Ch. 7 - List the order in which the following proteins and...Ch. 7 - Two viral genomes are sequenced, and the following...Ch. 7 - Matthew Meselson and Franklin Stahl demonstrated...Ch. 7 - Raymond Rodriguez and colleagues demonstrated...Ch. 7 - 7.22 Joel Huberman and Arthur Riggs used pulse...Ch. 7 - 7.23 Why do the genomes of eukaryotes, such as...Ch. 7 - Bloom syndrome (OMIM 210900) is an autosomal...Ch. 7 - 7.25 How does rolling circle replication (see...Ch. 7 - Telomeres are found at the ends of eukaryotic...Ch. 7 - A family consisting of a mother (I-1), a father...Ch. 7 - In a dideoxy DNA sequencing experiment, four...Ch. 7 - Prob. 29PCh. 7 - Using an illustration style and labeling similar...Ch. 7 - A PCR reaction begins with one double-stranded...Ch. 7 - Prob. 32PCh. 7 - Three independently assorting VNTR markers are...Ch. 7 - 7.34 A sufficient amount of a small DNA fragment...Ch. 7 - Prob. 35P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In bacteriophages and bacteria, the DNA is almost always organized into circular (closed loops) chromosomes. Phage l is an exception, maintaining its DNA in a linear chromosome within the viral particle. However, as soon as this DNA is injected into a host cell, it circularizes before replication begins. What advantage exists in replicating circular DNA molecules compared to linear molecules, characteristic of eukaryotic chromosomes?arrow_forwardWhy do eukaryotes need multiple origins of replication?arrow_forwardWhat enzymatic features of DNA polymerase prevent it from replicating one of the DNA strands at the ends of linear chromosomes? Compared with DNA polymerase, how is telomerase different in its ability to synthesize a DNA strand? What does telomerase use as its template for the synthesis of a DNA strand? How does the use of this template result in a telomere sequence that is tandemly repetitive?arrow_forward
- The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forwardWhat is the end-replication problem? Why, in the absence of telomerase, do the ends of linear chromosomes get progressively shorter each time the DNA is replicated?arrow_forwardWhat are some reasons why, in multicellular eukaryotes, genome size is not necessarily related to number of protein-coding genes or organismal complexity?arrow_forward
- What Is The Origin Of Replication? How many are found in prokaryotes and how many are found in eukaryotes?arrow_forwardWhat percentage of the DNA in the genome actually corresponds to genes? How much is actually protein-coding exons? What makes up the rest?arrow_forwardWhich of the followings statements are true about DNA polymerase? 1.) It can only go in one direction, meaning the lagging strand can't be synthesized continuously. 2.) It cannot start a DNA strand from scratch, so another enzyme is needed to create "primers" as a starting point. 3.) It cannot copy epigenetic marks (such as methyl groups) on its own; these must be "copied" onto the daughter DNA strand by other enzymes after DNA replication. 4.) All of the abovearrow_forward
- DNA polymerase occasionally incorporates the wrong nucleotide during DNA replication. If left unrepaired, the base-pair mismatch that results will lead to mutation in the next replication. As part of a template strand, the incorporated wrong base will direct the incorporation of a base complementary to itself, so the bases on both strands of the DNA at that position will now be different from what they were before the mismatch event. The MER-minus strain of yeast does not have a functional mismatch excision repair system, but it has normal base excision repair and nucleotide excision repair systems. Which of the following statements is correct about differences in the mutation spectrum between MER-minus and wildtype yeast? More than one answer is correct. Options: More point mutations will arise in MER-minus yeast. Fewer point mutations will arise in MER-minus yeast as compared with wildtype. Of the total point mutations that…arrow_forwardAll transposons would have these components among A- D EXCEPT A) O transposase |B) O nsertion sequences o O nverted repeat sequences D) O an ori (origin of replication)arrow_forward2) Replicating structures in DNA can be observed in the electron microscope. Regions being replicated appear as bubbles. a) How many replication forks are present? b) Assuming bidirectional replication, how many origins of replication are active in this DNA molecule? c) Assuming that all replication forks move at the same speed, which origin of replication was activated first (left, middle or right)? Why?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology - Intro to Cell Structure - Quick Review!; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=vwAJ8ByQH2U;License: Standard youtube license