EBK MICROBIOLOGY:W/DISEASES BY BODY...-
5th Edition
ISBN: 9780134608242
Author: BAUMAN
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 7, Problem 1SA
How does the genotype of a bacterium determine its
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
describe the process of reading a gene and turning it into a protein in a eukaryote.Your first paragraph should summarize transcription and your second paragraph should summarize translation. USE THE FOLLOWING 12 TERMS IN YOUR DECRIPTION: transcription, messenger RNA (mRNA), RNA polymerase, nucleus, ribosome, RNA splicing, exon, intron, translation, cytoplasm, transfer RNA (tRNA), codon.
Refer to the sequence below to answer the following questions.
5’- CACTTTTCAACTTGGCAGAAGCAATGTATCTCCGGATATAATCGCTTTCGAATTCG- 3’
3’- GTGAAAAGTTGAACCGTCTTCGTTACATAGAGGCCTATATTAGCGAAACTTAAGC- 5’
Is the sequence from a bacterial or a eukaryotic cell?Identify the characteristics that support the rationale for your decision. Which DNA strand serves as the template for transcription?
The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right.
CCTACCTTATGCCAAGTTGGGGATAAACTC
The left end of this molecule is the
end.
How many amino acids will be in the protein translated from this sequence?
What is the name (not abbreviation) of the fourth amino acid in the protein translated from this sequence?
The label on the end of the protein that is translated first is the
+ Jend.
Chapter 7 Solutions
EBK MICROBIOLOGY:W/DISEASES BY BODY...-
Ch. 7 - DNA replication requires a large amount of energy,...Ch. 7 - Vibrio vulnificus Infection Greg enjoyed Floridas...Ch. 7 - Prob. 2TMWCh. 7 - Prob. 3TMWCh. 7 - Why is the genetic ancestry of microbes much more...Ch. 7 - Prob. 1CCSCh. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - A plasmid is ___________. a. a molecule of RNA...Ch. 7 - Prob. 4MC
Ch. 7 - Prob. 5MCCh. 7 - Which of the following molecules functions as a...Ch. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - The Ames test ___________. a. uses auxotrophs and...Ch. 7 - Which of the following methods of DNA repair...Ch. 7 - Prob. 11MCCh. 7 - Prob. 12MCCh. 7 - Which of the following statements is true? a....Ch. 7 - Prob. 14MCCh. 7 - Although two cells are totally unrelated, one cell...Ch. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Before mutations can affect a population...Ch. 7 - Prob. 25MCCh. 7 - Fill in the Blanks 1. The three steps in RNA...Ch. 7 - Fill in the Blanks 2. A triplet of mRNA...Ch. 7 - Fill in the Blanks 3. Three effects of point...Ch. 7 - Fill in the Blanks 4. Insertions and deletions in...Ch. 7 - Fill in the Blanks 5. An operon consists of...Ch. 7 - Prob. 6FIBCh. 7 - Prob. 7FIBCh. 7 - Fill in the Blanks 8. A gene for antibiotic...Ch. 7 - Fill in the Blanks 9. ______ are nucleotide...Ch. 7 - Fill in the Blanks 10. ____________ is a...Ch. 7 - Fill in the Blanks 11.________ RNA carries amino...Ch. 7 - Fill in the Blanks 12. ______ RNA and ______ RNA...Ch. 7 - How does the genotype of a bacterium determine its...Ch. 7 - List several ways in which eukaryotic messenger...Ch. 7 - Compare and contrast intrans and exons.Ch. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Describe the operon model of gene regulation.Ch. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Describe the formation and function of mRNA, rRNA,...Ch. 7 - Prob. 9SACh. 7 - Explain the central dogma of genetics.Ch. 7 - Compare and contrast the processes of...Ch. 7 - Fill in the following table:Ch. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - The drugs ddC and AZT are used to treat AIDS....Ch. 7 - If molecules of mRNA have the following nucleotide...Ch. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Explain why an insertion of three nucleotides is...Ch. 7 - How could scientists use siRNA to turn off a...Ch. 7 - Prob. 5CTCh. 7 - Prob. 6CTCh. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Corynebacterium diphtheriae, the causative agent...Ch. 7 - Prob. 10CTCh. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Hydrogen bonds between complementary nucleotides...Ch. 7 - On average, RNA polymerase makes one error for...Ch. 7 - We have seen that wobble makes the genetic code...Ch. 7 - If a scientist synthesizes a DNA molecule with the...Ch. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Suppose you want to insert into your dog a gene...Ch. 7 - Using the following terms, fill in the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Rank the following in order of size: tRNA, DNA, mRNA.arrow_forwardConsider Molecule X in the sketch below: protein- ribosome X What is the name of X? Your answer should be one word, or a short two- or three-word phrase. Spelling counts. Note: if there is more than one possible answer, separate each answer with a comma. 0arrow_forwardPut the following in order from smallest to largest: nucleotide,genome, nitrogenous base, gene, nucleus, cell, codon, chromosome.arrow_forward
- Make a nucleosome by circling the DNA and protein locations.arrow_forwardUsing the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G mRNA: Codon: Anticodon: Amino Acids:arrow_forwardDoes a sequence contain a gene?arrow_forward
- Use the following information to answer the next question. The DNA strand shown below is thought to contain the genetic code for part of an enzyme B-galactosidase which is involved in lactose metabolism. (Read the DNA beginning at the left.) -A-T-A-T-G-G-G-G-C-A-T-G The second amino acid coded from the section of DNA for B-galactosidase is Select one: a. thymine b. tryptophan c. serine d. threoninearrow_forwardThe sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. ССТАССТТАТGCСАAGTTGGGGATАААСТС The left end of this molecule is the end. How many amino acids will be in the protein translated from this sequence? What is the name (not abbreviation) of the fourth amino acid in the protein translated from this sequence? The label on the end of the protein that is translated first is th v end. 5' Please answer all parts of the question. carboxyl 3' aminoarrow_forwardRead the images given before answering the question below. Identify the two common diseases that result from mutations in gene A?arrow_forward
- In cells, proteins are synthesized from a gene sequence via the process of transcription and translation. Which of the following complementary base pairings would you observe during the synthesis (the making) of a prokaryotic protein? [I am looking for the complementary base pairing(s) you would see as you go from a gene to a protein. Note that it is prokarryotic protein and not eukaryotic protein]. DNA with mRNA mRNA with tRNA mRNA with rRNA rRNA with tRNA A. 1, 2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1, 2, 3 and 4 are correctarrow_forwardConsider the following DNA sequence: -T -- -- If RNA primase used this section of DNA to make a primer, what would be the correct sequence of base pairs (from top to bottom)? T-A-C-C-G-T-T OT-U-C-C-G-U-U OA-T-G-G-C-A-A U-A-C-C-G-U-Uarrow_forwardMatch the following with the correct nucleic acid. (mRNA, tRNA, rRNA, or All RNA) 1. This molecule is complementary to DNA. 2. This molecule is part of translation. 3. This molecule is part of the ribosome. 4. This molecule contains anticodons. 5. This molecule is esponsible for bringing amino acids to the ribosome. 6. DNA is used as a template to create this type of RNA molecule. 7. This molecule is part of transcription. 8. This molecule contains codons.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license