Microbiology: A Systems Approach
4th Edition
ISBN: 9780073402437
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 7, Problem 13TF
Summary Introduction
Concept introduction:
Biofilms are the colonies formed by different species of bacteria. These colonies are initiated by one bacterium that attaches to the surface of vulnerable body parts, likea tooth or lung tissue. The other microbes subsequently attach to either the first bacterium or the inevitable sugar and protein secretions by it.
Biofilms are present in almost every natural environment, and it is an adaptation strategy of bacteria for the sustenance of their lives. The different species of bacteria cooperate and interact with each other while forming biofilms, and functioning in these colonies.
Biofilms are also involved inthe passing of genetic material from one microbe to its neighboring microbe. Therefore, they can cause infections and also develops resistance to antimicrobials.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?
Chapter 7 Solutions
Microbiology: A Systems Approach
Ch. 7.1 - List the essential nutrients of a bacterial cell.Ch. 7.1 - Prob. 2AYPCh. 7.1 - List and define four different terms that describe...Ch. 7.1 - Define saprobe and parasite, and provide microbial...Ch. 7.1 - Prob. 5AYPCh. 7.1 - Identify the effects of isotonic, hypotonic, and...Ch. 7.1 - Name two types of passive transport and three...Ch. 7.2 - Prob. 2CFCh. 7.2 - List and define five terms used to express a...Ch. 7.2 - Prob. 9AYP
Ch. 7.2 - Prob. 10AYPCh. 7.2 - Prob. 11AYPCh. 7.2 - Discuss characteristics of biofilms that...Ch. 7.3 - Summarize the steps of cell division used by most...Ch. 7.3 - Define doubling time and describe how it leads to...Ch. 7.3 - Compare and contrast the four phases of growth in...Ch. 7.3 - Prob. 16AYPCh. 7 - Prob. 1CFCh. 7 - The source of the necessary elements of life is a....Ch. 7 - An organism that can synthesize all its required...Ch. 7 - Chemoautotrophs can survive on ______ alone. a....Ch. 7 - Prob. 4MCQCh. 7 - Prob. 5MCQCh. 7 - Prob. 6MCQCh. 7 - A cell exposed to a hypertonic environment will...Ch. 7 - Prob. 8MCQCh. 7 - Prob. 9MCQCh. 7 - In a viable plate count, each _____ represents a...Ch. 7 - Prob. 11TFCh. 7 - Prob. 12TFCh. 7 - Prob. 13TFCh. 7 - Prob. 14TFCh. 7 - Prob. 15TFCh. 7 - Prob. 1CTQCh. 7 - Prob. 2CTQCh. 7 - Prob. 3CTQCh. 7 - Prob. 4CTQCh. 7 - Prob. 5CTQCh. 7 - Prob. 6CTQCh. 7 - Prob. 7CTQCh. 7 - Prob. 8CTQCh. 7 - Prob. 9CTQCh. 7 - Prob. 1CCCh. 7 - Prob. 2CCCh. 7 - Prob. 1VCCh. 7 - Prob. 2VCCh. 7 - Using the words that follow, please create a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
Essentials Health Info Management Principles/Prac...Health & NutritionISBN:9780357191651Author:BowiePublisher:Cengage
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Essentials Health Info Management Principles/Prac...
Health & Nutrition
ISBN:9780357191651
Author:Bowie
Publisher:Cengage
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
cell culture and growth media for Microbiology; Author: Scientist Cindy;https://www.youtube.com/watch?v=EjnQ3peWRek;License: Standard YouTube License, CC-BY