Human Anatomy & Physiology
1st Edition
ISBN: 9780805382952
Author: Erin C. Amerman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 6, Problem 3AYKA
Summary Introduction
To review:
The reason forabnormal slow growth, weakened bone, and fractures observed in Lucy Dupre, a2-year-old girl.
Introduction:
A 2-year-old girl from Canada was found to have an abnormal growth (slower growth as compared to normal kids). Her bones were weak and had fractures. Her parents have admitted that theydid not supplement Lucy’s diet with vitamin D.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In contrast to water-soluble vitamins, which must be part of our daily diet, fat-soluble vitamins can be stored in the body in amounts sufficient for many months. Suggest an explanation for this difference.
I am creating a medical scaffold made out of TPU to surgically implant around the pancreas for diabetic patients. The scaffold will have have capsules of islet beta cells which will diffuse into the pancreas to create a functional pancreas.
I will use the Brunauer–Emmett–Teller (BET) technique to determine the specific surface area and porosity of the scaffold material. In the context of the TPU scaffold, the BET technique will provide crucial insights into its porosity and its potential to facilitate the infusion of beta cells into the pancreas.
Can you explain the expected/ideal results from the BET test and how the test will help the design process of this medical scaffold.
Describe some general differences between fat-soluble and water-soluble vitamins. no handwritten answers please
Chapter 6 Solutions
Human Anatomy & Physiology
Ch. 6.1 - 1. What are the main organs of the skeletal...Ch. 6.1 - 2. What are the primary functions of the skeletal...Ch. 6.1 - 3. Look at Figure 6.2 and classify the following...Ch. 6.1 - 4. Where are compact bone and spongy bone...Ch. 6.1 - What are the two types of bone marrow, and what...Ch. 6.2 - What are the two components of bone ECM? How do...Ch. 6.2 - 2. Compare and contrast the locations and...Ch. 6.2 - Match the following terms with the correct...Ch. 6.3 - 1. How do primary bone and secondary bone...Ch. 6.3 - Walk through the basic steps of intramembranous...
Ch. 6.3 - For each type of ossification: a. Does spongy bone...Ch. 6.3 - 5. Which type of ossification:
a. involves a bone...Ch. 6.4 - What tissue type makes up the epiphyseal plate?Ch. 6.4 - How does bone grow in length from the epiphyseal...Ch. 6.4 - Prob. 3QCCh. 6.4 - Prob. 4QCCh. 6.4 - How is bone growth affected by the sex hormones...Ch. 6.5 - How do bone resorption and bone deposition differ?Ch. 6.5 - Explain how compression, continuous pressure on a...Ch. 6.5 - What role does parathyroid hormone play in calcium...Ch. 6.5 - 4. Walk through the basic steps of fracture...Ch. 6 - Which of the following is not a function of the...Ch. 6 - Match the following terms with the correct...Ch. 6 - Explain the differences between red bone marrow...Ch. 6 - 4. Mark the following statements about bone...Ch. 6 - Prob. 5CYRCh. 6 - 6. The branching pieces of bone in spongy bone...Ch. 6 - 7. Which bones form via intramembranous...Ch. 6 - Of the following statements, identify those that...Ch. 6 - What is the difference between a primary and...Ch. 6 - 10. The part of the epiphysis that does not...Ch. 6 - Long bones grow in length from the: a. diaphyseal...Ch. 6 - 12. Correctly order the following steps of bone...Ch. 6 - Explain the effect that the following hormones...Ch. 6 - Fill in the blanks. Bone deposition is carried out...Ch. 6 - Mark the following statements as true or false. If...Ch. 6 - 16. Which of the following influences bone...Ch. 6 - Correctly order the following steps of fracture...Ch. 6 - 1. Explain why a person who is wheelchair-bound or...Ch. 6 - 2. How could diseases of the kidney, skin, and/or...Ch. 6 - How could a disease that affects primarily...Ch. 6 - It used to be common practice in surgical fracture...Ch. 6 - Explain why young men who take anabolic steroids...Ch. 6 - Prob. 3AYKACh. 6 - Prob. 4AYKB
Knowledge Booster
Similar questions
- A new mother notices that one of her newborn twins has a yellow-orange complexion. Fearful that the child may have jaundice (a condition caused by bilirubin, a toxic yellow-orange pigment produced during the destruction of red blood cells), she takes him to her pediatrician. After examining the child and noting that his bilirubin levels are normal, the pediatrician declares him perfectly healthy and advises the mother to watch the child’s diet. Why? The other twin suffers from bluish coloration of this skin condition known as cyanosis (bluish tint). What can cause cyanosis? 2. Janine was taken to the ER for heat stroke and dehydration. Should she be given IV fluids that are hypertonic, isotonic, or hypotonic to cytosol? Explain your answer. 3. Grayson is receiving a drug treatment transdermally (through the skin). Explain why drugs delivered by this route are fat-soluble rather than water-soluble.arrow_forwardA) A mother had some antibiotic leftover from fighting a throat infection. She administered them to her son when he developed a cold. Explain what was wrong with this practice. B) Charmaine wants to eliminate all saturated and unsaturated fats from her diet. Explain why eliminating all fats from your diet can be bad for both your BODY as a whole and your CELLS?arrow_forwardWhich of the following diets would be best to help reduce the chance of hip dysplasia and osteochondrosis in young Great Danes? Select one: a. Provide foods with limited amounts of essential fatty acids and proteins to limit growth b. Feed on high in cellulose diet which takes longer for intestinal flora to ferment c. Provide free access to diet with highly digestible protein, fatty acids, and carbohydrates to stimulate maximal growth d. Feed diet containing proteins, fatty, acids, and vitamins in controlled amounts daily to maintain moderate growth ratearrow_forward
- Vitamin D deficiency can often be found as a single nutrient deficiency, that is, in an otherwise well-nourished person. Which of the following is the most likely reason? Question 100 options: a) Most vitamin D in the body does not come from natural sources in food, so access to food is not an important determinant of vitamin D status b) The individual has decreased intrinsic factor in the stomach c) Diets containing sufficient nutrients to promote growth can increase the requirements for vitamin D d) The content of vitamin D in foods depends on the soil in which the food was grownarrow_forwardMatch each item in column A with the most closely related item in column B. Place letters for answers in the spaces provided.arrow_forwardList four ways in which fiber is beneficial to the human body. Give a 2-3 sentence explanation for each. Create a plan for one meal that contains a good balance of the six nutrients. Be sure it also contains three different food sources of fiber. Please break this meal down into individual ingredients with approximate amounts of each ingredient.arrow_forward
- An individual has recently adopted a vegetarian lifestyle. She has been on this type of diet for approximately 6 months and admits that she has not been conscientious about making healthy food choices. She is feeling weak, appears gaunt, and is losing body mass. What type of nutrient biomolecule is most likely missing from her diet? a. nonessential amino acids b. essential amino acids c. fats (triglycerides) d. carbohydratesarrow_forwardRachael is a runner from Albuquerque, New Mexico. She has been competing in marathons for over 10 years and enjoys all types of challenges. Although she has competed in a few triathlons, she is not an experienced swimmer. She plans to train for a year and then attempt to swim 21 miles in the Everest Open Water Swim Competition. Rachael is extremely lean due to running. She is concerned about the water temperatures as they are very cold. Your discussion response must answer/prove the following: 1. What nutrition recommendations would you give Rachael in regard to fat intake to address her physical and dietary needs over the next 12 months as she trains for the swim? Include suggestions for before, during, and after the actual swim.arrow_forwardMutarotation affects the reducing property of carbohydrates. True Falsearrow_forward
- Whenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?arrow_forwardd) Vitamin A is important for various metabolism. Can we take in vitamin A only in the form of retinoic acids? Explain why.arrow_forwardWhy is it possible to argue that vitamin D is not a vitamin?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College