Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 6, Problem 26P
Figure 6.18 depicts Watson and Crick’s initial proposal for how the double-helical structure of DNA accounts for
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In the Watson-Crick model for the DNA double helix (B form) the A-T and G-C base pairs share all
but one of the following properties. Which is the exception?
None of the proton-binding groups in the purine and pyrimidine bases is in its charged or ionized form.
The plane of the base pair is roughly perpendicular to the axis of the helix in each case.
The number of hydrogen bonds formed between the two bases of the base pair is the same.
O The distance between the two glycosidic (base-sugar) bonds is the same in both base pairs, within a few
tenths of an angstrom.
The sequences of several short single-stranded DNA
molecules are shown below. Imagine each sequence as
a typical double-stranded DNA molecule, with
antiparallel strands held together by Watson-Crick base-
pairs between the complementary bases. Which of
these double-stranded molecules would have the
highest melting temperature (Tm)?
5' ACTGAGTCTCTGACTAGTCT 3'
5' ACTTAGTCTATGACTAGTCT 3'
5' ACTTAATCTATGAATAGTCT 3'
5' ACTGCGTCTCCGACTAGTCT
3'
5' ACTGCGTCTCCGACGAGCCT 3'
As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA:
3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'
Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________
Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47:
mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-
polypeptide chain: ________--________--________--________--________--________--________--________
Chapter 6 Solutions
Genetics: From Genes to Genomes
Ch. 6 - Griffith, in his 1928 experiments, demonstrated...Ch. 6 - Griffith, in his 1928 experiments, demonstrated...Ch. 6 - During bacterial transformation, DNA that enters a...Ch. 6 - Nitrogen and carbon are more abundant in proteins...Ch. 6 - If 30 of the bases in human DNA are A, a what...Ch. 6 - Which of the following statements are true about...Ch. 6 - Imagine you have three test tubes containing...Ch. 6 - What information about the structure of DNA was...Ch. 6 - A portion of one DNA strand of the human gene...Ch. 6 - When a double-stranded DNA molecule is exposed to...
Ch. 6 - A particular virus with DNA as its genetic...Ch. 6 - The underlying structure of DNA is very simple,...Ch. 6 - Prob. 13PCh. 6 - Bacterial transformation and bacteriophage...Ch. 6 - The CAP protein is shown bound to DNA in Fig....Ch. 6 - In Meselson and Stahls density shift experiments...Ch. 6 - When Meselson and Stahl grew E. coli in 15N medium...Ch. 6 - If you expose human tissue culture cells for...Ch. 6 - Draw a replication bubble with both replication...Ch. 6 - a. Do any strands of nucleic acid exist in nature...Ch. 6 - As Fig. 6.21 shows, DNA polymerase cleaves the...Ch. 6 - The bases of one of the strands of DNA in a region...Ch. 6 - Replicating structures in DNA can be observed in...Ch. 6 - Indicate the role of each of the following in DNA...Ch. 6 - Draw a diagram of replication that is occurring at...Ch. 6 - Figure 6.18 depicts Watson and Cricks initial...Ch. 6 - Researchers have discovered that during...Ch. 6 - A DNA synthesizer is a machine that uses automated...Ch. 6 - Bacterial cells were coinfected with two types of...Ch. 6 - A yeast strain with a mutant spo11- allele has...Ch. 6 - Imagine that you have done a cross between two...Ch. 6 - The Neurospora octad shown came from a cross...Ch. 6 - From a cross between e f g and e f g strains of...Ch. 6 - In Step 6 of Fig. 6.27, the resolvase enzyme...Ch. 6 - Figure 6.31shows four potential outcomes of...Ch. 6 - Each of the substrates for site-specific...Ch. 6 - Prob. 37PCh. 6 - Suppose that you could inject a wild-type mouse...Ch. 6 - C31 is a type of bacteriophage that infects...Ch. 6 - Cre is a recombinase enzyme encoded by a gene in...Ch. 6 - Like Cre/loxP recombination, site-specific...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- As shown, five DnaA boxes are found within the origin of replication in E. coli. Take a look at these five sequences carefully. A. Are the sequences of the five DnaA boxes very similar to each other? (Hint: Remember that DNA is double-stranded; think about these sequences in the forward and reverse directions.) B. What is the most common sequence for a DnaA box? In other words, what is the most common base in the first position, second position, and so on until the ninth position? The most common sequence is called the consensus sequence. C. The E. coli chromosome is about 4.6 million bp long. Based on random chance, is it likely that the consensus sequence for a DnaA box occurs elsewhere in the E. coli chromosome? If so, why aren’t there multiple origins of replication in E. coli?arrow_forwardThe two sides of the DNA double helix are connected by pairs of bases (adenine, thymine, cytosine, and guanine). Because of the geometric shape of these molecules, adenine bonds with thymine and cytosine bonds with guanine. The figure (Figure 1) shows the thymine-adenine bond. Each charge shown is ±e, and the H−N distance is 0.110 nm . Calculate the net force that thymine exerts on adenine. To keep the calculations fairly simple, yet reasonable, consider only the forces due to the O−H−N and the N−H−N combinations, assuming that these two combinations are parallel to each other. Remember, however, that in the O−H−N set, the O− exerts a force on both the H+ and the N−, and likewise along the N−H−N set. Express your answer in newtons. Is the net force attractive or repulsive?arrow_forwardIf a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAG Use the editor to format your answerarrow_forward
- A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) isconstructed, will its melting temperature be higher or lower?arrow_forwardWhich of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA binding protein? (Note that only one strand of the DNA is shown - you will find it helpful to write down the sequence and the sequence of the opposite strand to answer this question.) a) 5’- G A G C G A T C G C T C - 3’ b) 5’- G A G C G A G A G C G A - 3’ c) 5’- G A G C G A A G C G A G - 3’arrow_forwardThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.arrow_forward
- The DNA chromosome in E. coli contains approximately 4 million base pairs. The average gene contains about 1500 base pairs. Use this information to calculate the following (show all work ): a) The length in meters of this chromosome. b) The approximate number of genes in the chromosome (assuming no wasted DNA).arrow_forwardTo test whether you understand the processes involved in the Central Dogma of Molecular Genetics, determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. Partner DNA strands the mRNA strands the tRNA the formed amino acids the discussion of the entire procedurearrow_forwardIn the following sequence, a cytosine was deaminated and is now a uracil (underlined). 5’-GGTAUTAAGC-3’ a. Which repair pathway(s) could restore this uracil to cytosine? b. If the uracil is not removed before a DNA replication fork passes through, what will be the sequences of the two resulting double helices? Provide the sequences of both strands of both helices. Label the old and new strands and underline the mutation(s). c. Could the mismatch repair pathway fix the mutations you’ve indicated in part b? d. If the cell undergoes mitosis, and the replicated DNAs are distributed into the two daughter cells. Will 0, 1, or 2 daughter cells have a mutation in this sequence?arrow_forward
- this is the worst figure i have ever seen. Evidently A and B are different but the same color? From what I understand A would be a sliding clamp, and B is Primase? Is F rna primer (I think personally) or representing the SSBP? this is the worst diagram ever. the words that are for labeling are as follows: DNA polymerase III, sliding clamp, helicase, single-stranded binding protein (SSBPs), topoisomerase, RNA primer, newly synthesized DNA, primase, and DNA ligase.arrow_forwardEven though the eukaryotic genome is thousands of times larger than the prokaryotic genome, DNA replication times are relatively similar. Explain how this is possible.arrow_forwardThe Tm of a DNA strand can be calculated by hand using the formula: (2 ℃)(?????? ?? ? + ?) + (4 ℃)(?????? ?? ? + ?) = ??℃ Using this formular, calculate the Tm for the following DNA sequence: [CTTTCACAGCCACTATCCAGCGGTAC] Note: This formula has several limitations and is not useful for sequences longer than 14 bp. Use the Internet search to find an online Tm calculator. Use this calculator to find the Tm of the above sequence. Using information from your search, identify three factors that can affect the Tm.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license