
Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 6, Problem 28P
A DNA synthesizer is a machine that uses automated chemical synthesis to generate short, single strands of DNA of any given sequence. You have used the machine to synthesize the following three DNA molecules:
(DNA 1) | 5′ CTACTACGGATCGGG 3′ |
(DNA 2) | 5′ CCAGTCCCGATCCGT 3′ |
(DNA 3) | 5′ AGTAGCCAGTGGGGAAAAACCCCACTGG 3 |
Now you add the DNA molecules either singly or in combination to reaction tubes containing DNA polymerase, dATP, dCTP, dGTP, and dTTP in a buffered solution that allows DNA polymerase to function. For each of the reaction tubes, indicate whether DNA polymerase will synthesize any new DNA molecules, and if so, write the sequence(s) of any such DNAs.
a. | DNA 1 plus DNA 3 |
b. | DNA 2 plus DNA 3 |
c. | DNA 1 plus DNA 2 |
d. | DNA 3 only |
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Explain in a small summary how:
What genetic information can be obtained from a Punnet square? What genetic information cannot be determined from a Punnet square?
Why might a Punnet Square be beneficial to understanding genetics/inheritance?
In a small summary write down:
Not part of a graded assignment, from a past midterm
Chapter 6 Solutions
Genetics: From Genes to Genomes
Ch. 6 - Griffith, in his 1928 experiments, demonstrated...Ch. 6 - Griffith, in his 1928 experiments, demonstrated...Ch. 6 - During bacterial transformation, DNA that enters a...Ch. 6 - Nitrogen and carbon are more abundant in proteins...Ch. 6 - If 30 of the bases in human DNA are A, a what...Ch. 6 - Which of the following statements are true about...Ch. 6 - Imagine you have three test tubes containing...Ch. 6 - What information about the structure of DNA was...Ch. 6 - A portion of one DNA strand of the human gene...Ch. 6 - When a double-stranded DNA molecule is exposed to...
Ch. 6 - A particular virus with DNA as its genetic...Ch. 6 - The underlying structure of DNA is very simple,...Ch. 6 - Prob. 13PCh. 6 - Bacterial transformation and bacteriophage...Ch. 6 - The CAP protein is shown bound to DNA in Fig....Ch. 6 - In Meselson and Stahls density shift experiments...Ch. 6 - When Meselson and Stahl grew E. coli in 15N medium...Ch. 6 - If you expose human tissue culture cells for...Ch. 6 - Draw a replication bubble with both replication...Ch. 6 - a. Do any strands of nucleic acid exist in nature...Ch. 6 - As Fig. 6.21 shows, DNA polymerase cleaves the...Ch. 6 - The bases of one of the strands of DNA in a region...Ch. 6 - Replicating structures in DNA can be observed in...Ch. 6 - Indicate the role of each of the following in DNA...Ch. 6 - Draw a diagram of replication that is occurring at...Ch. 6 - Figure 6.18 depicts Watson and Cricks initial...Ch. 6 - Researchers have discovered that during...Ch. 6 - A DNA synthesizer is a machine that uses automated...Ch. 6 - Bacterial cells were coinfected with two types of...Ch. 6 - A yeast strain with a mutant spo11- allele has...Ch. 6 - Imagine that you have done a cross between two...Ch. 6 - The Neurospora octad shown came from a cross...Ch. 6 - From a cross between e f g and e f g strains of...Ch. 6 - In Step 6 of Fig. 6.27, the resolvase enzyme...Ch. 6 - Figure 6.31shows four potential outcomes of...Ch. 6 - Each of the substrates for site-specific...Ch. 6 - Prob. 37PCh. 6 - Suppose that you could inject a wild-type mouse...Ch. 6 - C31 is a type of bacteriophage that infects...Ch. 6 - Cre is a recombinase enzyme encoded by a gene in...Ch. 6 - Like Cre/loxP recombination, site-specific...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Noggin mutation: The mouse, one of the phenotypic consequences of Noggin mutationis mispatterning of the spinal cord, in the posterior region of the mouse embryo, suchthat in the hindlimb region the more ventral fates are lost, and the dorsal Pax3 domain isexpanded. (this experiment is not in the lectures).a. Hypothesis for why: What would be your hypothesis for why the ventral fatesare lost and dorsal fates expanded? Include in your answer the words notochord,BMP, SHH and either (or both of) surface ectoderm or lateral plate mesodermarrow_forwardNot part of a graded assignment, from a past midtermarrow_forwardNot part of a graded assignment, from a past midtermarrow_forward
- please helparrow_forwardWhat does the heavy dark line along collecting duct tell us about water reabsorption in this individual at this time? What does the heavy dark line along collecting duct tell us about ADH secretion in this individual at this time?arrow_forwardBiology grade 10 study guidearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License