
Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 6, Problem 28P
A DNA synthesizer is a machine that uses automated chemical synthesis to generate short, single strands of DNA of any given sequence. You have used the machine to synthesize the following three DNA molecules:
(DNA 1) | 5′ CTACTACGGATCGGG 3′ |
(DNA 2) | 5′ CCAGTCCCGATCCGT 3′ |
(DNA 3) | 5′ AGTAGCCAGTGGGGAAAAACCCCACTGG 3 |
Now you add the DNA molecules either singly or in combination to reaction tubes containing DNA polymerase, dATP, dCTP, dGTP, and dTTP in a buffered solution that allows DNA polymerase to function. For each of the reaction tubes, indicate whether DNA polymerase will synthesize any new DNA molecules, and if so, write the sequence(s) of any such DNAs.
a. | DNA 1 plus DNA 3 |
b. | DNA 2 plus DNA 3 |
c. | DNA 1 plus DNA 2 |
d. | DNA 3 only |
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get this answered with the colors and what type of connection was formed? Hydrophobic, ionic, or hydrogen.
Can I please get this answered with the colors and how the R group is suppose to be set up. Thanks
fa
How many different gametes, f₂ phenotypes and f₂ genotypes
can potentially be produced from individuals of the
following genotypes?
1) AaBb
i) AaBB
11) AABSC- AA Bb Cc Dd EE
Cal
bsm
nortuba
Chapter 6 Solutions
Genetics: From Genes to Genomes
Ch. 6 - Griffith, in his 1928 experiments, demonstrated...Ch. 6 - Griffith, in his 1928 experiments, demonstrated...Ch. 6 - During bacterial transformation, DNA that enters a...Ch. 6 - Nitrogen and carbon are more abundant in proteins...Ch. 6 - If 30 of the bases in human DNA are A, a what...Ch. 6 - Which of the following statements are true about...Ch. 6 - Imagine you have three test tubes containing...Ch. 6 - What information about the structure of DNA was...Ch. 6 - A portion of one DNA strand of the human gene...Ch. 6 - When a double-stranded DNA molecule is exposed to...
Ch. 6 - A particular virus with DNA as its genetic...Ch. 6 - The underlying structure of DNA is very simple,...Ch. 6 - Prob. 13PCh. 6 - Bacterial transformation and bacteriophage...Ch. 6 - The CAP protein is shown bound to DNA in Fig....Ch. 6 - In Meselson and Stahls density shift experiments...Ch. 6 - When Meselson and Stahl grew E. coli in 15N medium...Ch. 6 - If you expose human tissue culture cells for...Ch. 6 - Draw a replication bubble with both replication...Ch. 6 - a. Do any strands of nucleic acid exist in nature...Ch. 6 - As Fig. 6.21 shows, DNA polymerase cleaves the...Ch. 6 - The bases of one of the strands of DNA in a region...Ch. 6 - Replicating structures in DNA can be observed in...Ch. 6 - Indicate the role of each of the following in DNA...Ch. 6 - Draw a diagram of replication that is occurring at...Ch. 6 - Figure 6.18 depicts Watson and Cricks initial...Ch. 6 - Researchers have discovered that during...Ch. 6 - A DNA synthesizer is a machine that uses automated...Ch. 6 - Bacterial cells were coinfected with two types of...Ch. 6 - A yeast strain with a mutant spo11- allele has...Ch. 6 - Imagine that you have done a cross between two...Ch. 6 - The Neurospora octad shown came from a cross...Ch. 6 - From a cross between e f g and e f g strains of...Ch. 6 - In Step 6 of Fig. 6.27, the resolvase enzyme...Ch. 6 - Figure 6.31shows four potential outcomes of...Ch. 6 - Each of the substrates for site-specific...Ch. 6 - Prob. 37PCh. 6 - Suppose that you could inject a wild-type mouse...Ch. 6 - C31 is a type of bacteriophage that infects...Ch. 6 - Cre is a recombinase enzyme encoded by a gene in...Ch. 6 - Like Cre/loxP recombination, site-specific...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- C MasteringHealth MasteringNu × session.healthandnutrition-mastering.pearson.com/myct/itemView?assignment ProblemID=17396416&attemptNo=1&offset=prevarrow_forward10. Your instructor will give you 2 amino acids during the activity session (video 2-7. A. First color all the polar and non-polar covalent bonds in the R groups of your 2 amino acids using the same colors as in #7. Do not color the bonds in the backbone of each amino acid. B. Next, color where all the hydrogen bonds, hydrophobic interactions and ionic bonds could occur in the R group of each amino acid. Use the same colors as in #7. Do not color the bonds in the backbone of each amino acid. C. Position the two amino acids on the page below in an orientation where the two R groups could bond together. Once you are satisfied, staple or tape the amino acids in place and label the bond that you formed between the two R groups. - Polar covalent Bond - Red - Non polar Covalent boND- yellow - Ionic BonD - PINK Hydrogen Bonn - Purple Hydrophobic interaction-green O=C-N H I. H HO H =O CH2 C-C-N HICK H HO H CH2 OH H₂N C = Oarrow_forwardFind the dental formula and enter it in the following format: I3/3 C1/1 P4/4 M2/3 = 42 (this is not the correct number, just the correct format) Please be aware: the upper jaw is intact (all teeth are present). The bottom jaw/mandible is not intact. The front teeth should include 6 total rectangular teeth (3 on each side) and 2 total large triangular teeth (1 on each side).arrow_forward12. Calculate the area of a circle which has a radius of 1200 μm. Give your answer in mm² in scientific notation with the correct number of significant figures.arrow_forwardDescribe the image quality of the B.megaterium at 1000X before adding oil? What does adding oil do to the quality of the image?arrow_forwardWhich of the follwowing cells from this lab do you expect to have a nucleus and why or why not? Ceratium, Bacillus megaterium and Cheek epithelial cells?arrow_forward14. If you determine there to be debris on your ocular lens, explain what is the best way to clean it off without damaging the lens?arrow_forward11. Write a simple formula for converting mm to μm when the number of mm's is known. Use the variable X to represent the number of mm's in your formula.arrow_forward13. When a smear containing cells is dried, the cells shrink due to the loss of water. What technique could you use to visualize and measure living cells without heat-fixing them? Hint: you did this technique in part I.arrow_forward10. Write a simple formula for converting μm to mm when the number of μm's are known. Use the variable X to represent the number of um's in your formula.arrow_forward8. How many μm² is in one cm²; express the result in scientific notation. Show your calculations. 1 cm = 10 mm; 1 mm = 1000 μmarrow_forwardFind the dental formula and enter it in the following format: I3/3 C1/1 P4/4 M2/3 = 42 (this is not the correct number, just the correct format) Please be aware: the upper jaw is intact (all teeth are present). The bottom jaw/mandible is not intact. The front teeth should include 6 total rectangular teeth (3 on each side) and 2 total large triangular teeth (1 on each side).arrow_forwardarrow_back_iosSEE MORE QUESTIONSarrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License