Concepts of Genetics (11th Edition)
11th Edition
ISBN: 9780321948915
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 6, Problem 20PDQ
If further testing of the mutations in Problem 18 yielded the following results, what would you conclude about mutant 5?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
You are interested in studying resistance to heavy metals and have selected the yeast Saccharomyces cerevisea to conduct your studies. You have recovered a deletion mutant that does not tolerate high concentrations of zinc (grows poorly in zinc containing media ) and have designated the mutant pgz-1 (for poor growth in zinc ). (a) What is the advantage to the type of mutant used in this work? What class of mutagen was likely use to generate pgz-1?
( b) Do you expect the PGZ gene to be expressed in your mutant? Explain.
After mutagenesis of wild type Vibrio fisheri, you isolate two different mutant strains (A and B) that, unlike the wild type cells, fail to luminesce when grown to high density in a flask with appropriate medium. Curiously, however, when you inoculate both mutant strains in the same flask, you observe that the mixed (A+B) culture begins to emit light after growing dense.
a) What gene/functions are likely affected in each of the two mutants?
b) How does this explain their phenotypes?
If you wanted to make a mouse model for any of the following human genetic conditions (a–d), indicate which of thefollowing types of mice (i–vi) would be useful to your studies. If more than one answer applies, state which type ofmouse would most successfully mimic the human disease:(i) transgenic mouse overexpressing a normal mouse protein; (ii) transgenic mouse expressing normal amounts of amutant human protein; (iii) transgenic mouse expressing adominant negative form of a protein; (iv) a knockout mouse;(v) a conditional knockout mouse; and (vi) a knockin mousein which the normal allele is replaced with a mutant allelethat is at least partially functional. In all cases, the transgeneor the gene that is knocked out or knocked in is a form of thegene responsible for the disease in question.a. Marfan syndrome (a dominant disease caused byhaploinsufficiency for the FBN1 gene);b. A dominantly inherited autoinflammatory diseasecaused by a hypermorphic missense mutation in thegene PLCG2;c.…
Chapter 6 Solutions
Concepts of Genetics (11th Edition)
Ch. 6 - When the interrupted mating technique was used...Ch. 6 - In a transformation experiment involving a...Ch. 6 - In complementation studies of the rII locus of...Ch. 6 - Prob. 1CSCh. 6 - Prob. 2CSCh. 6 - Prob. 3CSCh. 6 - Prob. 4CSCh. 6 - HOW DO WE KNOW? In this chapter, we have focused...Ch. 6 - Review the Chapter Concepts list on p. 123. Many...Ch. 6 - With respect to F+ and F bacterial matings, answer...
Ch. 6 - List all major differences between (a) the F+ F...Ch. 6 - Describe the basis for chromosome mapping in the...Ch. 6 - In general, when recombination experiments are...Ch. 6 - Why are the recombinants produced from an Hfr F...Ch. 6 - Describe the origin of F bacteria and merozygotes.Ch. 6 - In a transformation experiment, donor DNA was...Ch. 6 - Describe the role of heteroduplex formation during...Ch. 6 - Explain the observations that led Zinder and...Ch. 6 - Prob. 12PDQCh. 6 - Prob. 13PDQCh. 6 - Two theoretical genetic strains of a virus (abc...Ch. 6 - The bacteriophage genome consists of many genes...Ch. 6 - If a single bacteriophage infects one E. coli cell...Ch. 6 - A phage-infected bacterial culture was subjected...Ch. 6 - In recombination studies of the rII locus in phage...Ch. 6 - In an analysis of rII mutants, complementation...Ch. 6 - If further testing of the mutations in Problem 18...Ch. 6 - Using mutants 2 and 3 from Problem 19, following...Ch. 6 - During the analysis of seven rII mutations in...Ch. 6 - In studies of recombination between mutants 1 and...Ch. 6 - Prob. 24ESPCh. 6 - An Hfr strain is used to map three genes in an...Ch. 6 - A plaque assay is performed beginning with 1 mL of...Ch. 6 - In a cotransformation experiment, using various...Ch. 6 - For the experiment in Problem 26, another gene, g,...Ch. 6 - Bacterial conjugation, mediated mainly by...Ch. 6 - A study was conducted in an attempt to determine...Ch. 6 - Prob. 31ESP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What detection method could be used to determine the Mutation at a palindromic site and what results could be achieved from that?arrow_forwardA classic way to isolate thymidylate synthase-negative mutants of bacteria is to treat a growing culture with thymidine and trimethoprim. Most of the cells are killed, and the survivors are greatly enriched in thymidylate synthase-negative mutants. (a) What phenotype would allow you to identify these mutants? (b) What is the biochemical rationale for the selection? (That is, why are the mutants not killed under these conditions?) (c) How would the procedure need to be modified to select mammalian cell mutants defective in thymidylate synthase?arrow_forwardA classic way to isolate thymidylate synthase-negative mutants of bacteria is to treat a growing culture with thymidine and trimetho- prim. Most of the cells are killed, and the survivors are greatly enriched in thymidylate synthase-negative mutants. (a) What phenotype would allow you to identify these mutants? (b) What is the biochemical rationale for the selection? (That is, why are the mutants not killed under these conditions?) (c) How would the procedure need to be modified to select mam- malian cell mutants defective in thymidylate synthase?arrow_forward
- A site-directed mutagenesis experiment was done on the catalytic triad of the serine protease subtilisin where all of the amino acids of the catalytic triad were mutated to alanine. The triple mutant enzyme was characterized kinetically and the mutant displayed a thousand-fold (103) rate enhancement over the uncatalyzed reaction. Explain the source of this rate enhancement. (The native wild-type subtilisin has a rate acceleration of 1010, when compared to the uncatalyzed reaction.)arrow_forwardThe DNA of a deletion mutant of λ bacteriophage has a length of 15.4383 μm instead of 19.6356 μm. How many base pairs are missing from this mutant? *arrow_forwardThe Ames test uses the reversion rate (His− to His+)to test compounds for mutagenicity.a. Is it possible that a known mutagen, like proflavin,would be unable to revert a particular His− mutantused in the Ames test? How do you think that theAmes test is designed to deal with this issue?b. Can you think of a way to use forward mutation(His+ to His−) to test a compound for mutagenicity? (Hint: Consider using the replica plating technique in Fig. 7.6.)c. Given that the rate of forward mutation is so muchhigher than the rate of reversion, why does the Amestest use the reversion rate to test for mutagenicity?arrow_forward
- With regard to Chargaff’s experiment described in Figure shown,answer the following:A. What is the purpose of paper chromatography?B. Explain why it is necessary to remove the bases in order todetermine the base composition of DNA.C. Would Chargaff’s experiments have been convincing if theyhad been done on DNA from only one species? Discuss.arrow_forwardname and briefly describe two methods you could use to identify the changes in DNA sequence found in 2 mutant mice strainsarrow_forwardThere are five substitution mutations in the dark-colored mutant Mc1r gene. Compare the DNA sequence of the light-colored wild-type Mc1r gene with the DNA sequence of the dark-colored mutant Mc1r gene. Indicate the locations of the five mutations by changing the font color to YELLOW for the five single DNA nucleotidesthat are mutated in the mutant Mc1r gene table. Using the information in the introduction, determine whether each of these mutations is a silent, missense, or nonsense mutation. Using the mutant Mc1r gene data, fill in the columns (including DNA, mRNA, and amino acid) in gene table 2 that contain a silent mutation with BLUE. Likewise, fill in the columns that contain a missense mutation with RED. Shade any columns that contain nonsense mutations with GREEN.arrow_forward
- A mutant has no activity for the enzyme isocitrate lyase.Does this result prove that the mutation is in the geneencoding isocitrate lyase?arrow_forwardMutation analysis of GCK gene in patients with diabetes revealed a c.114 T→A (shown in bold and underlined) substitution in heterozygote state. In order to check the mutation in healthy individuals, restriction enzyme analysis will be used. a) Which enzyme can we use to differentiate wild type and mutant sequence? Please indicate which allele (wild type or mutant allele) will be cut with the restriction enzyme. Use table 1 shown below. b) Draw the expected agarose gel result of a homozygous wild type, homozygous mutant and heterozygote individual after restriction enzyme analysis. ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGCATGGCAGCTCTAATGACAGGATGGTCACCCCTGCTGAGGCC ACTCCTGGTCACCATGACAACCACAGGCCCTCTCAGTATCACAGTAAGCCCTGGCAGGAGAATCCCCCACTCCAC ACCTGGCTGGAGCACGAAATGCCGAGCGGCGCCTGAGCCCCAGGGAAGCAGGCTAGGATGTGA Figure 1. GCK gene sequence. Length of the fragment is 213bp. Table1. The restriction enzymes and their recognition sequences. Restriction enzyme Recognition seguence www wwwtw ww Nar I GG/CGCC…arrow_forwardMutation analysis of GCK gene in patients with diabetes revealed a c.114 T A (shown in bold and underlined) substitution in heterozygote state. In order to check the mutation in healthy individuals, restriction enzyme analysis will be used. a) Which enzyme can we use to differentiate wild type and mutant sequence? Please indicate which allele (wild type or mutant allele) will be cut with the restriction enzyme. Use table 1 shown below. b) Draw the expected agarose gel result of a homozygous wild type, homozygous mutant and heterozygote individual after restriction enzyme analysis. ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGCATGGCAGCTCTAATGACAGGATGGTCACCCCTGC TGAGGCCACTCCTGGTCACCATGACAACCACAGGCCCTCTCAGTATCACAGTAAGCCCTGGCAGGAG AATCCCCCACTCCACACCTGGCTGGAGCACGAAATGCCGAGCGGCGCCTGAGCCCCAGGGAAGCAG GCTAGGATGTGA Figure 1. GCK gene sequence. Length of the fragment is 213bp. Table1. The restriction enzymes and their recognition sequences. Restriction enzyme Recognition seguence Nar I GG/CGCC Dde I c/TNAG…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY