
Concept explainers
To differentiate:
The generalized and specialized transduction.
Introduction:
The process in which the DNA of one bacteria is transferred to the genome of other bacteria by the bacteriophage is referred to as transduction. This process involves the use of a virus as a mediator for transferring genes from the donor to the recipient. It occurs in two phases, namely lytic and lysogenic phase. In the lytic phase, the phage injects its DNA to the host cell. Using the machinery of the host cell, it develops and get packed into a new cell, disrupts the host cell, and releases out. In the lysogenic phase, phage DNA integrates into the bacterial DNA and forms prophage. The phage

Want to see the full answer?
Check out a sample textbook solution
Chapter 6 Solutions
Concepts of Genetics (11th Edition)
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Developmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





