
Principles of Biology
2nd Edition
ISBN: 9781259875120
Author: Robert Brooker, Eric P. Widmaier Dr., Linda Graham Dr. Ph.D., Peter Stiling Dr. Ph.D.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 5.3, Problem 1TYK
Summary Introduction
Introduction:
Particles usually move from an area of higher concentration to lower concentration. Movement of particles can take place in a different manner such as simple diffusion, facilitated diffusion, and active transport. Movement of molecules takes place across a membrane.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 5 Solutions
Principles of Biology
Ch. 5.1 - Which of the following is not a characteristic of...Ch. 5.1 - Prob. 2TYKCh. 5.2 - In an animal cell, how can changes in lipid...Ch. 5.2 - Prob. 2CCCh. 5.2 - Prob. 1TYKCh. 5.2 - Which of the following changes would make a...Ch. 5.3 - Prob. 1BCCh. 5.3 - Prob. 1CCCh. 5.3 - Prob. 2BCCh. 5.3 - Prob. 2CC
Ch. 5.3 - Prob. 1TYKCh. 5.3 - Prob. 2TYKCh. 5.4 - Prob. 1CCCh. 5.4 - Prob. 1TYKCh. 5.4 - Prob. 2TYKCh. 5.5 - Prob. 1BCCh. 5.5 - Prob. 1TYKCh. 5.6 - Prob. 1CCCh. 5.6 - A form of endocytosis that involves the formation...Ch. 5.7 - Prob. 1CCCh. 5.7 - Prob. 2CCCh. 5.7 - Prob. 1BCCh. 5.7 - Anchoring junctions that adhere adjacent animal...Ch. 5 - Which of the following statements best describes...Ch. 5 - Which of the following events in a biological...Ch. 5 - Prob. 3TYCh. 5 - Carbohydrates of the plasma membrane are bonded to...Ch. 5 - Which of the following movements would not be an...Ch. 5 - Prob. 6TYCh. 5 - Prob. 7TYCh. 5 - What features of a membrane are a major...Ch. 5 - Prob. 9TYCh. 5 - Large particles can be brought into the cell by...Ch. 5 - With your textbook closed, draw and describe the...Ch. 5 - Describe two different ways that integral membrane...Ch. 5 - A principle of biology is that living organisms...Ch. 5 - Prob. 1CBQCh. 5 - With regard to bringing solutes into the cell...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Anaerobic Respiration; Author: Bozeman Science;https://www.youtube.com/watch?v=cDC29iBxb3w;License: Standard YouTube License, CC-BY