
Human Physiology: An Integrated Approach (7th Edition)
7th Edition
ISBN: 9780321981226
Author: Dee Unglaub Silverthorn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 5, Problem 8RQ
Summary Introduction
Introduction: If the cell has a higher concentration of non-penetrating solutes as compared to the solution, then the solution is hypotonic. If the cell has a lower concentration of non-penetrating solutes then the solution is hypertonic and if the concentrations of non-penetrating solutes are the same in the cell and the solution, then the solution is isotonic.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 5 Solutions
Human Physiology: An Integrated Approach (7th Edition)
Ch. 5 - Using what you learned about the naming...Ch. 5 - Prob. 2CCCh. 5 - Prob. 3CCCh. 5 - If the 58-kg Reference Woman has total body water...Ch. 5 - A mother brings her baby to the emergency room...Ch. 5 - Prob. 6CCCh. 5 - Two compartments are separated by a membrane that...Ch. 5 - Prob. 8CCCh. 5 - Prob. 9CCCh. 5 - Prob. 10CC
Ch. 5 - If the distance over which a molecule must diffuse...Ch. 5 - Prob. 12CCCh. 5 - Which is more likely to cross a cell membrane by...Ch. 5 - Prob. 14CCCh. 5 - Prob. 15CCCh. 5 - Prob. 16CCCh. 5 - Positively charged ions are called _____, and...Ch. 5 - Name four functions of membrane proteins.Ch. 5 - Prob. 19CCCh. 5 - Prob. 20CCCh. 5 - If a channel is lined with amino acids that have a...Ch. 5 - Prob. 22CCCh. 5 - Liver cells (hepatocytes) are able to convert...Ch. 5 - Prob. 24CCCh. 5 - What would you call a carrier that moves two...Ch. 5 - Prob. 26CCCh. 5 - Prob. 27CCCh. 5 - Name the two membrane protein families associated...Ch. 5 - Prob. 29CCCh. 5 - Prob. 30CCCh. 5 - Prob. 31CCCh. 5 - Prob. 32CCCh. 5 - Prob. 33CCCh. 5 - Prob. 34CCCh. 5 - Prob. 1RQCh. 5 - Distinguish between active transport and passive...Ch. 5 - Which of the following processes are examples of...Ch. 5 - List four factors that increase the rate of...Ch. 5 - List the three physical methods by which materials...Ch. 5 - A cotransporter is a protein that moves more than...Ch. 5 - Prob. 7RQCh. 5 - Prob. 8RQCh. 5 - Prob. 9RQCh. 5 - What determines the osmolarity of a solution? In...Ch. 5 - Prob. 11RQCh. 5 - Prob. 12RQCh. 5 - Prob. 13RQCh. 5 - Prob. 14RQCh. 5 - The membrane potential at which the electrical...Ch. 5 - Prob. 16RQCh. 5 - Create a map of transport across cell membranes...Ch. 5 - Draw a large rectangle to represent the total body...Ch. 5 - What factors influence the rate of diffusion...Ch. 5 - Define the following terms and explain how they...Ch. 5 - Prob. 21RQCh. 5 - Prob. 22RQCh. 5 - Prob. 23RQCh. 5 - Prob. 24RQCh. 5 - Prob. 25RQCh. 5 - Prob. 26RQCh. 5 - The following terms have been applied to membrane...Ch. 5 - Prob. 28RQCh. 5 - NaCl is a nonpenetrating solute and urea is a...Ch. 5 - Prob. 30RQCh. 5 - Prob. 31RQCh. 5 - What is the osmolarity of half-normal saline (=...Ch. 5 - Prob. 33RQCh. 5 - Prob. 34RQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
The Cell Membrane; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=AsffT7XIXbA;License: Standard youtube license