A&P Bundle
11th Edition
ISBN: 9780134761404
Author: Martini
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 5, Problem 16RQ
Summary Introduction
To determine:
The function of arrector pili muscles.
Introduction:
The skin is composed of the cutaneous membrane and accessory structures. In the accessory structures the hair and the hair follicles are of particular importance. The arrector pili muscles are the smooth muscle cells that surround the hair. They are activated by stimulation and cause the hair follicles to stand erect.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 5 Solutions
A&P Bundle
Ch. 5 - Identity the layers of the epidermis.Ch. 5 - Dandruff is caused by excessive shedding of cells...Ch. 5 - A splinter that penetrates to the third layer of...Ch. 5 - Why does taking a bath cause wrinkly fingertips...Ch. 5 - Some criminals sand the Lips of their fingers so...Ch. 5 - Prob. 6CPCh. 5 - Prob. 7CPCh. 5 - Prob. 8CPCh. 5 - Prob. 9CPCh. 5 - Prob. 10CP
Ch. 5 - Prob. 11CPCh. 5 - Prob. 12CPCh. 5 - Prob. 13CPCh. 5 - Name the two major pigments in the epidermis.Ch. 5 - Why does exposure to sunlight darken skin?Ch. 5 - Prob. 16CPCh. 5 - Prob. 17CPCh. 5 - Prob. 18CPCh. 5 - Describe a typical strand of hair.Ch. 5 - What happens when the arrector pili muscle...Ch. 5 - Once a burn on the forearm that destroys the...Ch. 5 - Prob. 22CPCh. 5 - Prob. 23CPCh. 5 - Prob. 24CPCh. 5 - Which type of skin gland is most affected by the...Ch. 5 - Prob. 26CPCh. 5 - Prob. 27CPCh. 5 - Prob. 28CPCh. 5 - Prob. 29CPCh. 5 - Why can skin regenerate effectively even after...Ch. 5 - Prob. 31CPCh. 5 - Why does hair turn while or gray with age?Ch. 5 - Prob. 1RQCh. 5 - The two major components of the integumentary...Ch. 5 - Prob. 3RQCh. 5 - Prob. 4RQCh. 5 - Prob. 5RQCh. 5 - Prob. 6RQCh. 5 - Prob. 7RQCh. 5 - The accessory structures of the integument include...Ch. 5 - Prob. 9RQCh. 5 - Prob. 10RQCh. 5 - Prob. 11RQCh. 5 - The primary function of sensible perspiration is...Ch. 5 - Prob. 13RQCh. 5 - Prob. 14RQCh. 5 - Prob. 15RQCh. 5 - Prob. 16RQCh. 5 - Prob. 17RQCh. 5 - What two major layers constitute the dermis, and...Ch. 5 - List the four phases in the regeneration of the...Ch. 5 - Contrast insensible perspiration and sensible...Ch. 5 - Prob. 21RQCh. 5 - Prob. 22RQCh. 5 - Prob. 23RQCh. 5 - Prob. 24RQCh. 5 - Prob. 25RQCh. 5 - Prob. 26RQCh. 5 - Prob. 27RQCh. 5 - Prob. 28RQCh. 5 - Prob. 29RQCh. 5 - One of the factors to which lie detectors respond...Ch. 5 - Prob. 31RQCh. 5 - Prob. 1CCCh. 5 - Grandpa has trouble when its hot outside Whats...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegePrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
TISSUE REPAIR Part 1: Repair - Regeneration; Author: ilovepathology;https://www.youtube.com/watch?v=t-5EjlS6qjk;License: Standard YouTube License, CC-BY