Bundle: Biology: The Unity and Diversity of Life, Loose-leaf Version, 14th + LMS Integrated for MindTap Biology, 2 terms (12 months) Printed Access Card
14th Edition
ISBN: 9781305775480
Author: Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 47, Problem 3CT
The use of off-road recreational vehicles may double in the next 20 years. Enthusiasts would like increased access to government-owned deserts. Some argue that it’s the perfect place for off-roaders because “There’s nothing there.” Explain whether you agree, and why.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Do you think oil drilling should be permitted in the Arctic National Wildlife Refuge? Describe it's pros and cons.
NASA describes desertification as the wearing down of the land, a reduction in land productivity that may not be reversible. This means the land cannot
support the same plant and animal life as it could in the past. Desertification is often caused or exacerbated by humans as they mismanage the land while
growing or harvesting a natural resource.
Question: Human mismanagement/abuse of land can happen in many ways. Please choose the 2 options below that do NOT represent causes
of desertification due to land mismanagement.
Graphics: Image 1: Before and After images of a location in Africa, Image 2: Vulnerability of land areas across the world to being desertified.
Desertification Vulnerability
VULNERABILITY
Dry
Mle Prare
ALE
High
HumdNet nerle
Very Hgh
loeiglacier
O Underground mining operations
O Land development on the outskirts of a town
O Overgrazing by cattle
Deforestation of trees and brush
O Intensive farming in a dry climate
When a fossil fuel reserves decreases, the cost of fossil fuel energy will be more affordable for most people . Why is this an unlikely scenario?
Chapter 47 Solutions
Bundle: Biology: The Unity and Diversity of Life, Loose-leaf Version, 14th + LMS Integrated for MindTap Biology, 2 terms (12 months) Printed Access Card
Ch. 47 - Prob. 1SQCh. 47 - Prob. 2SQCh. 47 - Warm air ______ and it holds _____ water than cold...Ch. 47 - A rain shadow is a reduction in rainfall ________....Ch. 47 - Prob. 1DAACh. 47 - Prob. 2DAACh. 47 - Prob. 3DAACh. 47 - Prob. 4DAACh. 47 - Prob. 5SQCh. 47 - Prob. 6SQ
Ch. 47 - Biome distribution depends on ______. a. climate...Ch. 47 - Prob. 8SQCh. 47 - Prob. 9SQCh. 47 - Prob. 10SQCh. 47 - Chemoautotrophic bacteria and archaea are the main...Ch. 47 - Prob. 12SQCh. 47 - Prob. 13SQCh. 47 - Unrelated species in geographically separated...Ch. 47 - Match the terms with the most suitable...Ch. 47 - London, England, is at the same latitude as...Ch. 47 - Increased industrialization in China has...Ch. 47 - The use of off-road recreational vehicles may...
Additional Science Textbook Solutions
Find more solutions based on key concepts
What is the difference between histology and radiography?
Human Anatomy (8th Edition)
Why are mutants used as test organisms in the Ames test?
Laboratory Experiments in Microbiology (11th Edition)
2. Why is it that the range of resting blood pressures of humans is best represented by a bell-shaped curve co...
Human Biology: Concepts and Current Issues
Problem Set
True or False? Indicate whether each of the following statements about membrane transport is true (...
Becker's World of the Cell (9th Edition)
Propose a model for the assembly of a flagellum in a typical Gram-positive cell envelope.
Prescott's Microbiology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Many argue that government freshwater subsidies promote the expansion of productive farmland, stimulate local economies, and help to keep food and electricity prices low. Do you think this is reason enough for governments to continue providing subsidies to farmers and cities? Why or why not? Incorporate what type of feedback would be needed to garner enough legislative support for your position.arrow_forwardWhich option is a nonrenewable source of energy Petroleum Sunlight Water Windarrow_forwardCan someone help me with this please pleasearrow_forward
- We encounter so many risks in our daily lives ranging from just crossing the street to get to work or school, to our recreational favorites. How can we justify the resources being spent on environmental risks when those risks may be less than that encountered in a day surfing at the shore, skiing, bicycling or just driving to work?arrow_forwardWhat are some advantages of ecotourism for a state like Hawai‘i? What might be a potential disadvantage? Describe a source of ecotourism that exists—or could exist—in your own regionarrow_forwardAbout O 16% O 20% O 36% O 26% O 46% of U.S. land is used as grassland, pasture and range.arrow_forward
- Which of the following resources is currently considered renewable but may become a nonrenewable resource as Earth's population expands? a water b timber c coal d windarrow_forwardIs Sustainable Development Goal realistic or idealistic? Why or why not? Give examples that support your point of view.arrow_forwardIlog PasigLahin is one of the non-government organizations (NGO) concerned with environmental awareness and protection, particularly along the Pasig River. As a student, what can you do to support and protect bodies of water in the Philippines, like the Pasig River? What actions will you be able to take? to help mitigate the current climate change?arrow_forward
- Urban forests, green roofs, parks, and other green spaces can improve environmental conditions for city dwellers in a number of ways. (g) In addition to improving air quality and reducing energy usage in cities, increasing the amount of vegetation can decrease urban runoff. Describe one way increasing the amount of vegetation in cities can lead to decreased runoff. (h) Describe one cultural benefit that may result from increasing the amount of vegetation in cities.arrow_forwardThe Amazon rainforest continues to be cleared for agricultural land. For each square meter of this rainforest area that was cleared and replaced by farmland, by about how much was NPP reduced each year? Show how you got your answer.arrow_forwardHunting is banned in all national parks but not outside of them. During bear hunting season, conservation officers conduct routine checks. One day, the OPP receive a report from campers that they heard shots fired inside Algonquin National Park. The OPP transmits this information to the Natural Resources office. Based on the campers' tip, check points are set up on the highway through Huntsville. All of the hunters that bring bears past the checkpoint have licenses, but in order to check out the camper's story several hairs are pulled from each carcass for DNA checks. The data below shows DNA containing two STR regions for the bear carcasses that were examined on the day after the campers' complaint, and two known reference samples of bear sub-populations around Huntsville, including inside the park. POSSIBLE POACHER'S DNA DATA Reference #1: Genotype Indigenous to Park TCAGGGACGACGACGACGACGACGACCCATTATCGGAGTTATTATTAGATCGATCCATTCGGATCGGATAT Reference #2: Genotype Indigenous to Park…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningUnderstanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:Cengage
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage
Guidelines for Physical Activity; Author: Versus Arthritis;https://www.youtube.com/watch?v=Nt3Qh_oJ3YY;License: Standard Youtube License