Campbell Biology in Focus (2nd Edition)
2nd Edition
ISBN: 9780321962751
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 4.4, Problem 3CC
WHAT IF? Imagine a protein that functions in the ER but requires modification in the Golgi apparatus before it can achieve that function. Describe the protein’s path through the cell, starting with the mRNA molecule that specifies the protein.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Order+the+following+of+protein+sentesis+sequence+from+earliest: (a)tRNA molecule bring specific amino acids to he mRNA molecule. b)mRNA nucleotides join with exposed DNA bases and form a molecule of mRNA.(c)The two stands of a DNA molecule separate. (d)Peptide bonds form between the amino acids. (e)the mRNA molecule leave the nucleus. (f) a ribosome attached to the mRNA molecule.
asap please
A partially filled diagram of eukaryotic gene structure is shown below. Label the following additional elements in the empty boxes. One label must be used twice: a) 3'UTR, b) 5'UTR, c) exon, d) intron, e) promoter
C. The primary structure is the linear sequence of amino acids linked together in a polymer (determined by the genetic code è mRNA codons). Draw the chemical structure of the primary structure of the SerCys-Lys polymer (with the appropriate covalent bonds) that would result if the ribosome completed the condensation reactions. Clearly label the N- and C- terminus of the polypeptide.
Chapter 4 Solutions
Campbell Biology in Focus (2nd Edition)
Ch. 4.1 - Prob. 1CCCh. 4.1 - Prob. 2CCCh. 4.2 - Briefly describe the structure and function of the...Ch. 4.2 - Prob. 2CCCh. 4.3 - What role do ribosomes play in carrying out...Ch. 4.3 - Describe the molecular composition of nucleoli,...Ch. 4.3 - WHAT IF? As a cell begins the process of dividing,...Ch. 4.4 - Describe the structural and functional...Ch. 4.4 - Describe how transport vesicles integrate the...Ch. 4.4 - WHAT IF? Imagine a protein that functions in the...
Ch. 4.5 - Describe two characteristics shared by...Ch. 4.5 - Prob. 2CCCh. 4.5 - Prob. 3CCCh. 4.6 - Prob. 1CCCh. 4.6 - WHAT IF? Males afflicted with Kartageners syndrome...Ch. 4.7 - In what way are the cells of plants and animals...Ch. 4.7 - Prob. 2CCCh. 4.7 - MAKE CONNECTIONS The polypeptide chain that makes...Ch. 4 - Which structure is not part of the endomembrane...Ch. 4 - Which structure is common to plant and animal...Ch. 4 - Which of the following is present in a prokaryotic...Ch. 4 - Prob. 4TYUCh. 4 - Cyanide binds to at least one molecule involved in...Ch. 4 - What is the most likely pathway taken by a newly...Ch. 4 - Which cell would be best for studying lysosomes?...Ch. 4 - DRAW IT From memory, draw two eukaryotic cells....Ch. 4 - SCIENTIFIC INQUIRY In studying micrographs of an...Ch. 4 - FOCUS ON EVOLUTION Compare different aspects of...Ch. 4 - FOCUS ON ORGANIZATION Considering some of the...Ch. 4 - Prob. 12TYU
Additional Science Textbook Solutions
Find more solutions based on key concepts
Some people consider Pasteur or Koch to be the Father of Microbiology, rather than Leeuwenhoek. Why might they ...
Microbiology with Diseases by Body System (4th Edition)
Describe the evolution of mammals, tracing their synapsid lineage from early amniote ancestors to true mammals....
Loose Leaf For Integrated Principles Of Zoology
The correct term for production of offspring. Introduction: Reproduction is an important life process for most ...
Biology Illinois Edition (Glencoe Science)
On what molecule does the anticodon appear? Explain the role of this molecule in protein synthesis.
Human Physiology: An Integrated Approach (7th Edition)
Define histology.
Fundamentals of Anatomy & Physiology (11th Edition)
Nursing Student with Neuropathic Pain
Tamara Costa broke her right tibia and has undergone two separate surger...
Human Anatomy & Physiology (11th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- VISUALIZE Sketch a simple flow diagram that shows the relationships among the following: RNA, translation, DNA, transcription, and polypeptide.arrow_forwardAKS 5c1: Which of the following models BEST represents protein synthesis? * O MRNA (UAC AAA) - DNA (ATG TTT) Amino Acid Sequence (Lysine-Alanine) - Amino Acid Sequence (Methionine- DNA (TAC AAA) RNA (AUG UUU) Phenylalanine) RNA (AUG UUU) DNA (TAC Amino Acid Sequence (Methionine-Phenylalanine) AAA) DNA (AUG UUU) RNA (TAC AAA) Phenylalanine) - Amino Acid Sequence (Methionine- AKS 5c1: Using codon wheel below, which of the models correctly represents the usage of the base pairing rule, the correct sequence of events, and creation of proteins at the ribosomes? *arrow_forward1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You can use the one-letter code for valine (V) and do not have to draw the amino acid structure. Label the tRNA and amino acid binding sites on the enzyme. Explain the function of valine-aminoacyl tRNA synthetase and explain why there are 20 related enzymes in every cell.arrow_forward
- The lab you joined recently want to investigate the role of uncoupling protein in-vivo models. Your supervisor knew that you have learnt in-vivo model and uncoupling in your BIOTECH 2CB3 course. Based on the information you learnt you have to make a list of organisms that could be used kind to study the mechanism of uncoupling of proteins? What are you are going tp suggest as an ideal model to study the uncoupling proteins in-vivo? only one answer options: newborn mammals, hibernating animals animals acclimated to cold environments animals live in hot weather I and II I and IIIarrow_forwardPlz asaparrow_forwardWHAT IF? A certain mutation in E. coli changes the lacoperator so that the active repressor cannot bind. Howwould this affect the cell’s production of β-galactosidase?arrow_forward
- a. 0.02z3 ML Below are the general steps of protein synthesis. What is the correct sequence of protein synthesis? 1-ribosome bonds amino acids together; 2-MRNA leaves the nucleus; 3- TRNA molecules pick up amino acids; 4-DNA double helix unwinds; 5-TRNA anticodon links with mRNÁ codon; 6-polypeptide chain completed; 7-MRNA binds to ribosome; 8-mRNA transcibed Select one: a. 6-5-7-3-2-1-8-4 b. 4-2-8-3-7-5-1-6 c. 1-8-6-7-5-3-4-2 d. 4-8-2-7-3-5-1-6 e. 1-2-3-4-5-6-7-8 When using the high power objective, you should not adjust the Select one:arrow_forwardPlease asaparrow_forwardAKS 5c1: Given the statements below, what is the correct sequence of events for protein synthesis? * 1. DNA is used as a template to create mRNA 2. Amino acids are bonded together to make a polypeptide 3. MRNA molecule binds to a ribosome 4. The ribosome releases both the mRNA molecule and the polypeptide 5. TRNA binds to the ribosome O 1, 2,3, 4, 5 1,3, 5, 2, 4 2, 4, 1, 5, 3 4, 2, 1, 5, 3 AKS 5c1: The model below represents the process of protein synthesis. What isarrow_forward
- © Macmillan Learning Predict the amino acid sequences of peptides formed by ribosomes in response to each mRNA sequence, assuming that the reading frame begins with the first three bases in each sequence. Construct the peptides using the one-letter codes of the amino acids. GQSLI GGUCAGUCGCUCCUGAUU: Incorrect Answer UUGGAUGCGCCAUAAUUUGCU: LDAP Correct Answer < Feedback O Macmillan Learning Sorry, that's incorrect. You have not correctly entered the Х peptide sequence corresponding to the first mRNA sequence. The codons within the first mRNA sequence are: GGU, CAG, UCG, CUC, CUG, and AUU. Find each codon within the amino acid codon table and identify its corresponding amino acid. HDRCA CAUGAUGCCUGUUGCUAC: Incorrect Answer MDE AUGGACGAA: Correct Answerarrow_forwardGene Expression: 14) Look at the diagram: a) For each of the molecules in the diagram, identify what type of molecule they are, and label their ends (3',5',N,C). b) For each arrow, name the process and identify the major enzymes involved. c) Where do each of these activities take place in a bacterial cell? In a eukaryotic cell? Draw a picture if it helps you explain it.arrow_forwardExplain well. Asaparrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY