Laboratory Manual for Hole's Human Anatomy & Physiology Fetal Pig Version
15th Edition
ISBN: 9781260165418
Author: SHIER, David
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 4, Problem 6IA
Consider the following DNA sequence:
CATGTGTAGTCTAAA
a. Write the sequence of the DNA strand that would bereplicated from this one.
b. Write the sequence of the RNA molecule that would betranscribed from the DNA strand.
c. State how many codons the sequence specifies.
d. State how many amino acids the sequence specifies.
e. Use table 4.2 to write the sequence of amino acids that thisDNA sequence encodes.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The table attached shows a partial DNA sequence from a human. Answer the following questions based on the table
A. Name the codon that is formed from base triplet number 2 on the DNA sequence.
B. Write down the names of the amino acids coded for by base triplets 6 and 7. Write down the full names
C. Draw the structure of the dipeptide Thr-Cys at pH7. Clearly indicate the following:
the amino terminus (N)
the carboxyl terminus (C)
a peptide bond
an α-carbon atom
D. If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed?
E.The following is a sequence of base triplets in DNA
F.If guanine, found in the first base triplet, is removed, explain how this would affect the…
Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’
a. Write the sequence for the complementary DNA strand.
b. Write the sequence of the RNA complementary to the strand shown
Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?
Chapter 4 Solutions
Laboratory Manual for Hole's Human Anatomy & Physiology Fetal Pig Version
Ch. 4 - Prob. 1PCh. 4 - 2 What type of molecule is formed by the anabolism...Ch. 4 - Distinguish between dehydration synthesis and...Ch. 4 - Prob. 4PCh. 4 - Prob. 5PCh. 4 - Prob. 6PCh. 4 - Prob. 7PCh. 4 - Prob. 8PCh. 4 - Prob. 9PCh. 4 - Prob. 10P
Ch. 4 - Prob. 11PCh. 4 - Prob. 12PCh. 4 - Prob. 13PCh. 4 - Prob. 14PCh. 4 - Prob. 15PCh. 4 - Prob. 16PCh. 4 - Prob. 17PCh. 4 - Prob. 18PCh. 4 - Prob. 19PCh. 4 - Prob. 20PCh. 4 - 21 Define genetic code.
Ch. 4 - Prob. 22PCh. 4 - Prob. 23PCh. 4 - Prob. 24PCh. 4 - Prob. 25PCh. 4 - 26 Explain how genetic information is carried from...Ch. 4 - Prob. 27PCh. 4 - Prob. 28PCh. 4 - Prob. 29PCh. 4 - Prob. 30PCh. 4 - Prob. 31PCh. 4 - Prob. 32PCh. 4 - Distinguish between anabolism and catabolism. (p....Ch. 4 - Prob. 2CACh. 4 - Prob. 3CACh. 4 - 4 Describe how an enzyme interacts with its...Ch. 4 - Prob. 5CACh. 4 - Prob. 6CACh. 4 - Prob. 7CACh. 4 - 8 Explain the importance of a rate-limiting...Ch. 4 - Prob. 9CACh. 4 - Prob. 10CACh. 4 - Prob. 11CACh. 4 - Prob. 12CACh. 4 - Prob. 13CACh. 4 - Explain how the oxidation of molecules inside...Ch. 4 - Prob. 15CACh. 4 - Prob. 16CACh. 4 - Prob. 17CACh. 4 - Prob. 18CACh. 4 - Prob. 19CACh. 4 - Prob. 20CACh. 4 - Prob. 21CACh. 4 - Distinguish among a gene, an exome, and a genome....Ch. 4 - Define gene expression. (p. 132)Ch. 4 - Prob. 24CACh. 4 - Prob. 25CACh. 4 - Prob. 26CACh. 4 - Prob. 27CACh. 4 - Prob. 28CACh. 4 - Prob. 29CACh. 4 - Prob. 30CACh. 4 - Prob. 31CACh. 4 - Prob. 32CACh. 4 - Prob. 33CACh. 4 - Prob. 34CACh. 4 - Prob. 35CACh. 4 - Prob. 36CACh. 4 - Prob. 37CACh. 4 - Discuss three ways that the genetic code protects...Ch. 4 - How can the same molecule be both a reactant...Ch. 4 - Prob. 2IACh. 4 - Prob. 3IACh. 4 - Prob. 4IACh. 4 - Prob. 5IACh. 4 - Consider the following DNA sequence:...Ch. 4 - Prob. 7IA
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider the following wild-type double-stranded DNA sequence: 5' TATGAA AGT3 non-transcribed strand (sense strand) 5' 3' ATACTTTCA transcribed strand In the space below, write ONE of the possible DNA sequences of the transcribed strand shown above that results from BOTH a single substitution mutation of the first codon following the start codon that would also cause a nonsense mutation. Use the mRNA codon chart in the Appendix of your manual to help you. Answer: Checkarrow_forwardDNA from a eukaryotic gene was isolated, denatured, and hybridized to the mRNA transcribed from the gene; the hybridized structure was then observed with an electron microscope. The adjoining diagram shows the structure that was observed. a. Identify and label the exons and introns in this hybridized structure.arrow_forwardUse the first picture and codon table to answer the following questions.arrow_forward
- A mutation that changes a C to a T causes a type of Ehlers-Danlos syndrome, forming a “stop” codon and resulting in shortened procollagen. Consult the genetic code and suggest one way that this can happen.arrow_forwardShown below is a portion of a DNA sequence ( 31 base pairs long ) that encodes the last amino acids of a protein : The first three underlined base pairs indicate the frame and include the coding region . 123456789 A. Write the peptide sequence of the last 6 amino acids of the protein . Label both ends of the peptide . B. A insertion of one base pair causes the protein to decrease in length by 5 amino acids . With respect to the sequence given above , where does this insertion occur , and what base pair will you insert ? C. An change of one base pair leads to the protein to increase in length by one amino acid. With respect to the sequence given above , which base pair would you change ? How would you change this base pair for the protein to increase in length by one amino acid ?arrow_forwardConsider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5’-UACCGAAUGUCU-3’ Note for letters a and b: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu a. Using the table of the genetic code, determine the sequence of amino acids. b. If mutation occurs by substitution of the 12th nucleotide with cytidine-5’-monophosphate, what is the resulting amino acid sequence? c. What type of mutation occurred? Choose from same sense, missense and non-sense.arrow_forward
- Consider the following gene with their respective introns and exons 5’ – TCATGCATTTTGCGCGGGAAATAGCTCA – 3’ 3’ – AGTACGTAAAACGCGCCCTTTATCGAGT – 5’ Using the bottom as a template strand, create: A. A primary mRNA transcript B. A processed mRNA transcriptC. Highlight where your START and STOP codons are in your processed transcript (if there are any). D. The resulting protein sequencearrow_forwardConsider the following segment of DNA:5′ GCTTCCCAA 3′3′ CGAAGGGTT 5′Assume that the top strand is the template strand usedby RNA polymerase.a. Draw the RNA transcribed.b. Label its 5′ and 3′ ends.c. Draw the corresponding amino acid chain.d. Label its amino and carboxyl ends.Repeat parts a through d, assuming the bottom strand tobe the template strand.arrow_forwardConsider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the sequence of the DNA strand that would be replicated from this one. GTACACATCAGATT 2. White the sequence of the messenger RNA (MRNA) molecule that would be transcribed from the DNA strand. 30 GUACACAUCAGAU00 37 38 39 3. State how many codons the sequence specifies. 40 41 42 43 44 4. State how many amino acids the sequence specifies. 45arrow_forward
- In your own wordsarrow_forwarda. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and 3' ends. b. translate this RNA sequence in 1a into a protein sequence c. Give the sequence of mRNA that would be transcribed off of the top strand and label its 5' and 3' ends. d. Translate this RNA sequence in 1c into a protein sequencearrow_forwardRefer to a genetic code table for the question. below is a portion of the template strand of a particular gene sequence. Which of the following would be the correct sequence of amino acids in the protein that this portion of the gene encodes? (Note that there are no entrance in this gene sequence, and this portion is found in the middle of the coding sequence, past the start codon, so you should transcribe and translate the entire portion of this sequence) template DNA : 3' - ACG GGT TCC TTT AAC GCG TAG -5' A) Thr-Gly-Ser-Phe-Asn-Ala B) Cys-Pro-Arg-Lys-Leu-Arg-Ile C) there is not enough information given to determine the amino acid sequence of this portion of the gene .arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY