
EBK GENERAL, ORGANIC, AND BIOLOGICAL CH
7th Edition
ISBN: 8220100853180
Author: STOKER
Publisher: CENGAGE L
expand_more
expand_more
format_list_bulleted
Question
Chapter 4, Problem 4.74EP
Interpretation Introduction
Interpretation:
The correct explanation of ionic compounds does not have individual molecules.
Concept Introduction:
Ions are formed by loss or gain of electrons. The formation of ion requires the presence of two elements, these two elements are one is metal atom and another one is non-metal atom. Metal atom loses electrons and non-metal atom accepts electrons.
Ionic solids or ionic crystal is formed due to the transference of electrons from one atom to another. Both positive and negative charged atoms are held together by attractive forces.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 4 Solutions
EBK GENERAL, ORGANIC, AND BIOLOGICAL CH
Ch. 4.1 - Prob. 1QQCh. 4.1 - Prob. 2QQCh. 4.1 - Prob. 3QQCh. 4.2 - How many valence electrons are present in an atom...Ch. 4.2 - Prob. 2QQCh. 4.2 - Prob. 3QQCh. 4.2 - Prob. 4QQCh. 4.2 - Which of the following elements would have the...Ch. 4.3 - Prob. 1QQCh. 4.3 - Prob. 2QQ
Ch. 4.3 - Prob. 3QQCh. 4.4 - In terms of subatomic particles, a Ca2+ ion...Ch. 4.4 - Prob. 2QQCh. 4.4 - Prob. 3QQCh. 4.4 - Prob. 4QQCh. 4.5 - An atom with a 1s22s22p4 electron configuration...Ch. 4.5 - Prob. 2QQCh. 4.5 - Prob. 3QQCh. 4.5 - Prob. 4QQCh. 4.5 - Prob. 5QQCh. 4.6 - Prob. 1QQCh. 4.6 - Prob. 2QQCh. 4.6 - Prob. 3QQCh. 4.7 - What is the chemical formula of the ionic compound...Ch. 4.7 - What is the chemical formula of the ionic compound...Ch. 4.7 - Given that Z2 ions are present in the ionic...Ch. 4.7 - Prob. 4QQCh. 4.8 - Prob. 1QQCh. 4.8 - Which of the following is a correct description of...Ch. 4.9 - Prob. 1QQCh. 4.9 - Prob. 2QQCh. 4.9 - Prob. 3QQCh. 4.9 - Prob. 4QQCh. 4.9 - Prob. 5QQCh. 4.9 - Prob. 6QQCh. 4.9 - The correct name for the binary ionic compound...Ch. 4.9 - Prob. 8QQCh. 4.10 - Prob. 1QQCh. 4.10 - Which of the following statements about polyatomic...Ch. 4.10 - The nitrate, sulfate, and phosphate ions have,...Ch. 4.10 - Prob. 4QQCh. 4.11 - Prob. 1QQCh. 4.11 - Prob. 2QQCh. 4.11 - Prob. 3QQCh. 4.11 - Prob. 4QQCh. 4.11 - Prob. 5QQCh. 4.11 - What is the chemical formula for the compound...Ch. 4 - Contrast the two general types of chemical bonds...Ch. 4 - Contrast the two general types of chemical...Ch. 4 - How many valence electrons do atoms with the...Ch. 4 - How many valence electrons do atoms with the...Ch. 4 - Prob. 4.5EPCh. 4 - Prob. 4.6EPCh. 4 - Write the complete electron configuration for each...Ch. 4 - Write the complete electron configuration for each...Ch. 4 - Prob. 4.9EPCh. 4 - For each of the following pairs of representative...Ch. 4 - How many of the highlighted elements in the...Ch. 4 - How many of the highlighted elements in the...Ch. 4 - Draw Lewis symbols for atoms of each of the...Ch. 4 - Draw Lewis symbols for atoms of each of the...Ch. 4 - Each of the following Lewis symbols represents a...Ch. 4 - Each of the following Lewis symbols represents a...Ch. 4 - Prob. 4.17EPCh. 4 - Prob. 4.18EPCh. 4 - What is the chemical property of the noble gases...Ch. 4 - Prob. 4.20EPCh. 4 - Prob. 4.21EPCh. 4 - Prob. 4.22EPCh. 4 - Give the chemical symbol for each of the following...Ch. 4 - Give the chemical symbol for each of the following...Ch. 4 - What would be the chemical symbol for an ion with...Ch. 4 - What would be the chemical symbol for an ion with...Ch. 4 - Fill in the blanks in each line in the following...Ch. 4 - Fill in the blanks in each line in the following...Ch. 4 - Fill in the blanks in each line of the following...Ch. 4 - Fill in the blanks in each line of the following...Ch. 4 - Identify element X by giving its chemical symbol,...Ch. 4 - Prob. 4.32EPCh. 4 - Prob. 4.33EPCh. 4 - Prob. 4.34EPCh. 4 - Prob. 4.35EPCh. 4 - Draw Lewis symbols for the following ions. a. O2...Ch. 4 - What is the charge on the monatomic ion formed by...Ch. 4 - What is the charge on the monatomic ion formed by...Ch. 4 - Indicate the number of electrons lost or gained...Ch. 4 - Indicate the number of electrons lost or gained...Ch. 4 - Which noble gas has an electron configuration...Ch. 4 - Prob. 4.42EPCh. 4 - Which noble gas is isoelectronic with each of the...Ch. 4 - Which noble gas is isoelectronic with each of the...Ch. 4 - Prob. 4.45EPCh. 4 - Indicate whether or not each of the following...Ch. 4 - Prob. 4.47EPCh. 4 - Prob. 4.48EPCh. 4 - Prob. 4.49EPCh. 4 - Write the electron configuration of the following....Ch. 4 - How many valence electrons are present in each of...Ch. 4 - Prob. 4.52EPCh. 4 - Using Lewis structures, show how ionic compounds...Ch. 4 - Using Lewis structures, show how ionic compounds...Ch. 4 - The following Lewis symbols for ions have the...Ch. 4 - Prob. 4.56EPCh. 4 - Prob. 4.57EPCh. 4 - Prob. 4.58EPCh. 4 - Prob. 4.59EPCh. 4 - Prob. 4.60EPCh. 4 - The component elements for four binary ionic...Ch. 4 - Prob. 4.62EPCh. 4 - Write the complete chemical formula (symbol and...Ch. 4 - Write the complete chemical formula (symbol and...Ch. 4 - Write the chemical formula for the ionic compound...Ch. 4 - Prob. 4.66EPCh. 4 - Prob. 4.67EPCh. 4 - What is the chemical formula of the ionic compound...Ch. 4 - A representative element (X) forms an ion with a 2...Ch. 4 - A representative element (Z) forms an ion with a...Ch. 4 - Prob. 4.71EPCh. 4 - The following questions pertain to the ionic...Ch. 4 - Prob. 4.73EPCh. 4 - Prob. 4.74EPCh. 4 - Prob. 4.75EPCh. 4 - Prob. 4.76EPCh. 4 - Prob. 4.77EPCh. 4 - Prob. 4.78EPCh. 4 - Prob. 4.79EPCh. 4 - Which of the following binary compounds would be...Ch. 4 - Name the following binary ionic compounds, each of...Ch. 4 - Name the following binary ionic compounds, each of...Ch. 4 - Calculate the charge on the metal ion in the...Ch. 4 - Calculate the charge on the metal ion in the...Ch. 4 - Prob. 4.85EPCh. 4 - Prob. 4.86EPCh. 4 - Prob. 4.87EPCh. 4 - Prob. 4.88EPCh. 4 - Name each of the following binary ionic compounds....Ch. 4 - Name each of the following binary ionic compounds....Ch. 4 - Prob. 4.91EPCh. 4 - Name each compound in the following pairs of...Ch. 4 - Prob. 4.93EPCh. 4 - Write chemical formulas for the following binary...Ch. 4 - Prob. 4.95EPCh. 4 - Write chemical formulas for the following binary...Ch. 4 - Prob. 4.97EPCh. 4 - Prob. 4.98EPCh. 4 - Fill in the blanks in each line of the following...Ch. 4 - Prob. 4.100EPCh. 4 - Prob. 4.101EPCh. 4 - Prob. 4.102EPCh. 4 - Prob. 4.103EPCh. 4 - How many oxygen atoms are present in each of the...Ch. 4 - Prob. 4.105EPCh. 4 - Prob. 4.106EPCh. 4 - Prob. 4.107EPCh. 4 - Prob. 4.108EPCh. 4 - Prob. 4.109EPCh. 4 - Prob. 4.110EPCh. 4 - How many ions are present per formula unit in each...Ch. 4 - Prob. 4.112EPCh. 4 - Name the following compounds, all of which contain...Ch. 4 - Prob. 4.114EPCh. 4 - Prob. 4.115EPCh. 4 - Prob. 4.116EPCh. 4 - Prob. 4.117EPCh. 4 - Write formulas for the following compounds, all of...Ch. 4 - Write chemical formulas for the following...Ch. 4 - Write chemical formulas for the following...Ch. 4 - Prob. 4.121EPCh. 4 - Prob. 4.122EPCh. 4 - Prob. 4.123EPCh. 4 - Prob. 4.124EP
Knowledge Booster
Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
