Biological Science (6th Edition)
6th Edition
ISBN: 9780321976499
Author: Scott Freeman, Kim Quillin, Lizabeth Allison, Michael Black, Emily Taylor, Greg Podgorski, Jeff Carmichael
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 4, Problem 12PIAT
Summary Introduction
To analyze:
The orientation of the sugar–phosphate backbone in Pauling’s model compared with the one proposed by Watson and Crick to analyze whether Pauling’s structure could exist in cells or not with explanation.
Introduction:
The structure of DNA followed today was earlier published incorrect by researchers Linus Pauling and Robert Corey in 1953 due to insufficient data and an overloaded research schedule. This model proposed that DNA has triple-stranded structure with the nitrogenous bases on the exterior and the sugar-phosphate backbones clustered in the middle. In the 1950s, the race to solve the secondary structure of DNA became intense. In an uncharacteristic rush to publish, Linus Pauling erroneously proposed a triple-stranded structure in February 1953. This model had the nitrogenous bases on the exterior and the sugar–phosphate backbones clustered in the middle.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In the Watson-Crick model for the DNA double helix (B form) the A-T and G-C base pairs share all
but one of the following properties. Which is the exception?
None of the proton-binding groups in the purine and pyrimidine bases is in its charged or ionized form.
The plane of the base pair is roughly perpendicular to the axis of the helix in each case.
The number of hydrogen bonds formed between the two bases of the base pair is the same.
O The distance between the two glycosidic (base-sugar) bonds is the same in both base pairs, within a few
tenths of an angstrom.
State the properties of the Watson-Crick model of DNA in the following categories:
a) number of polynucleotide chains
b) polarity (strand direction running same or opposite
c) bases on interior or exterior of molecule
d) sugar/phosphate on interior or exterior of molecule
e) which bases pair with which
f) right- or left-handed helix
The sequences of several short single-stranded DNA
molecules are shown below. Imagine each sequence as
a typical double-stranded DNA molecule, with
antiparallel strands held together by Watson-Crick base-
pairs between the complementary bases. Which of
these double-stranded molecules would have the
highest melting temperature (Tm)?
5' ACTGAGTCTCTGACTAGTCT 3'
5' ACTTAGTCTATGACTAGTCT 3'
5' ACTTAATCTATGAATAGTCT 3'
5' ACTGCGTCTCCGACTAGTCT
3'
5' ACTGCGTCTCCGACGAGCCT 3'
Chapter 4 Solutions
Biological Science (6th Edition)
Ch. 4 - What are the four nitrogenous bases found in RNA?...Ch. 4 - 2. What determines the primary structure of a DNA...Ch. 4 - 3. Which of the following describes the synthesis...Ch. 4 - Prob. 4TYKCh. 4 - Prob. 5TYUCh. 4 - Prob. 6TYUCh. 4 - What would be the sequence of the strand of DNA...Ch. 4 - 8. According to the RNA world model, a ribozyme...Ch. 4 - Make a concept map (see BioSkills 12 ) that...Ch. 4 - Prob. 10TYPSS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Watson and Crick used an approach called model building to deduce the structure of the DNA double helix.How does this differ from the more conventional experimental approach that is undertaken in a research laboratory? In this regard, why was the experiment of Meselsonand Stahl considered to be of such critical importance?arrow_forwardAs shown, five DnaA boxes are found within the origin of replication in E. coli. Take a look at these five sequences carefully. A. Are the sequences of the five DnaA boxes very similar to each other? (Hint: Remember that DNA is double-stranded; think about these sequences in the forward and reverse directions.) B. What is the most common sequence for a DnaA box? In other words, what is the most common base in the first position, second position, and so on until the ninth position? The most common sequence is called the consensus sequence. C. The E. coli chromosome is about 4.6 million bp long. Based on random chance, is it likely that the consensus sequence for a DnaA box occurs elsewhere in the E. coli chromosome? If so, why aren’t there multiple origins of replication in E. coli?arrow_forwardLet’s assume the linker region of DNA averages 54 bp in length. How many molecules of H2A would you expect to find in a DNA sample that is 46,000 bp in length?arrow_forward
- Draw the structure of the following DNA sequence (5’-AG-3’) hydrogen bonded through Watson-Crick base pairing to the complementary PNA sequence (Cterminus-TC-Nterminus). Make sure to include both the sugar phosphate backbone of your DNA sequence, as well as the peptide backbone of your PNA sequence. DNA: 5’-AG-3’ PNA: (C)-TC-(N)arrow_forwardDraw the following structures and rate their relative solubilities in water (most soluble to least soluble): deoxyribose, guanine, phosphate. How are these solubilities consistent with the three-dimensional structure of double-stranded DNA?arrow_forward1) a) Sketch an A-form helix and a B-form helix, highlighting the differences between them. Indicate the bases and backbone as lines. Label the major and minor grooves. 2) Sketch a ribose in the pucker that is expected in RNA. 3) Sketch a 2’ deoxyribose in the pucker that is expected in DNA. 4) Draw a GCG triplet (GC Watson-Crick), with perfect geometry. Draw the bases only, with dR’s at the N-9 positions of the purines (Gs) and at the N1 positions of the pyrimidine (C)arrow_forward
- X-ray was used by Rosalind Franklin and Maurice Wilkins to study the molecular structure of DNA. Why is their finding not accepted by Watson and Crick? Explain.arrow_forwardWhen DNA is heated, it denatures; that is, the strands separate because hydrogen bonds are broken and some base-stacking and hydrophobic interactions are disrupted. The higher the temperature, the larger the number of hydrogen bonds that are broken. After reviewing DNA base pair structure, determine which of the following molecules will denature first as the temperature is raised. Explain your reasoning. a. 5′-GCATTTCGGCGCGTTA-3′ 3′-CGTAAAGCCGCGCAAT-5′ b. 5′-ATTGCGCTTATATGCT-3′ 3′-TAACGCGAATATACGA-5′arrow_forwardWhich of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA binding protein? (Note that only one strand of the DNA is shown - you will find it helpful to write down the sequence and the sequence of the opposite strand to answer this question.) a) 5’- G A G C G A T C G C T C - 3’ b) 5’- G A G C G A G A G C G A - 3’ c) 5’- G A G C G A A G C G A G - 3’arrow_forward
- What is the complete base composition of a double-stranded eukaryotic DNA that contains 22% guanine? Why is it necessary to specify that the DNA is double-stranded?arrow_forwardThe image below shows the base cytosine and a methylated form of cytosine that occurs frequently in the human genome. Use your knowledge of DNA structure to answer the following question: a) Does methylation of cytosine affect its ability to base-pair with guanine? Explain b) Could methylation of cytosine affect the binding of a protein that interacts with a C-G base-pair in the major groove? Explain your answer.arrow_forward1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license