Biological Science (6th Edition)
Biological Science (6th Edition)
6th Edition
ISBN: 9780321976499
Author: Scott Freeman, Kim Quillin, Lizabeth Allison, Michael Black, Emily Taylor, Greg Podgorski, Jeff Carmichael
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 4, Problem 12PIAT
Summary Introduction

To analyze:

The orientation of the sugar–phosphate backbone in Pauling’s model compared with the one proposed by Watson and Crick to analyze whether Pauling’s structure could exist in cells or not with explanation.

Introduction:

The structure of DNA followed today was earlier published incorrect by researchers Linus Pauling and Robert Corey in 1953 due to insufficient data and an overloaded research schedule. This model proposed that DNA has triple-stranded structure with the nitrogenous bases on the exterior and the sugar-phosphate backbones clustered in the middle. In the 1950s, the race to solve the secondary structure of DNA became intense. In an uncharacteristic rush to publish, Linus Pauling erroneously proposed a triple-stranded structure in February 1953. This model had the nitrogenous bases on the exterior and the sugar–phosphate backbones clustered in the middle.

Blurred answer
Students have asked these similar questions
In the Watson-Crick model for the DNA double helix (B form) the A-T and G-C base pairs share all but one of the following properties. Which is the exception? None of the proton-binding groups in the purine and pyrimidine bases is in its charged or ionized form. The plane of the base pair is roughly perpendicular to the axis of the helix in each case. The number of hydrogen bonds formed between the two bases of the base pair is the same. O The distance between the two glycosidic (base-sugar) bonds is the same in both base pairs, within a few tenths of an angstrom.
State the properties of the Watson-Crick model of DNA in the following categories: a) number of polynucleotide chains b) polarity (strand direction running same or opposite c) bases on interior or exterior of molecule d) sugar/phosphate on interior or exterior of molecule e) which bases pair with which f) right- or left-handed helix
The sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license