Biological Science (6th Edition)
6th Edition
ISBN: 9780321976499
Author: Scott Freeman, Kim Quillin, Lizabeth Allison, Michael Black, Emily Taylor, Greg Podgorski, Jeff Carmichael
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 4, Problem 10TYPSS
Summary Introduction
To explain:
A model to illustrate how the two particles (a circle and a square) could be brought together by linking them to short single-stranded DNA (deoxyribonucleic acid) molecules.
Introduction:
The linking of two strands of DNA occurs by complementary base pairing. In the field of nanotechnology, DNA is used like Velcro to assemble tiny particles into structures that are < 0.0001 mm in size. If the DNA sequence linked to the circle is GGATC, then provide the sequence linked to the square and identify the 5′ and 3′ ends of each strand.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Try to propose structures for a genetic material that are substantiallydifferent from the double helix. Remember that the genetic material must have a way to store information and a way to be faithfully replicated.
Consider the following DNA strand with the following nucleotide sequence:
3’-ATATCAGAGAATATCA-5’
The nucleotide sequence of the complementary DNA strand is .
b. The nucleotide sequence of the antisense strand used in the transcription process is .
c. The nucleotide sequence of the mRNA strand produced after the transcription process is
2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol).
% A?
%C?
%G?
Explain in details the influence of ions and water (solvent) in stabilizing DNA structure
Chapter 4 Solutions
Biological Science (6th Edition)
Ch. 4 - What are the four nitrogenous bases found in RNA?...Ch. 4 - 2. What determines the primary structure of a DNA...Ch. 4 - 3. Which of the following describes the synthesis...Ch. 4 - Prob. 4TYKCh. 4 - Prob. 5TYUCh. 4 - Prob. 6TYUCh. 4 - What would be the sequence of the strand of DNA...Ch. 4 - 8. According to the RNA world model, a ribozyme...Ch. 4 - Make a concept map (see BioSkills 12 ) that...Ch. 4 - Prob. 10TYPSS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Draw the structure of a dideoxynucleotide that would be used for DNA sequencing, and explain why they result in chain termination. Write out the sequence of the first 20 nucleotides for the gene shown in the sequencing gel below (remember to start at the bottom of the gel and work upward, from smallest to largest fragments).arrow_forwardGive typing answer with explanation and conclusionarrow_forwardThe following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate groups are filled circles. A. Is this a DNA or an RNA Molecule? B. Where is the 3’ end of this tetranucleotide? C. Given that the DNA strand which served as a template for the synthesis of this tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?arrow_forward
- Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5' a. What would be the first 5 bases at the 3' end of the complementary strand? b. What would be the first 10 bases at the 5' end of the complementary strand? c. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair? with respect to the G-C base pair? d. In the given segment in problem 1, illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragmentarrow_forwardGive typed full explanationarrow_forwardThe complementarity of its two strands is the underlying reason that DNA can be faithfully copied. Propose alternative chemical structures that could be faithfully copied.arrow_forward
- Single-stranded binding proteins (SSBPs) bind to single-stranded DNA at the replication fork and prevent formation of short hairpin sequences that would otherwise impede DNA synthesis. What sorts of sequences in single-stranded DNA might be able to form a hairpin? Write out an example of a sequence that could form a 5-nucleotide hairpin loop, and draw it.arrow_forwardLet’s say that you want to find out the difference in nucleotide sequence among two DNA strands, one of which is isolated from the liver of a liver cancer patient and the other one is isolated from the liver of a healthy individual. How you can do that, please explain in detailsarrow_forwardThe sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'arrow_forward
- Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?arrow_forwardTry to explain the function of DNA gyrase with a drawingarrow_forwardThe sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you identify important features - capitalization does not affect the nucleotide indicated. 5' ...atacaATGcATGTCAaCTAcg[a]agatccgTAGaTAACATtCATatc...3' a) Underneath that strand, write the sequence of the strand of DNA it would be paired with in a double-stranded helix. Use the single letter code A-adenosine, G-guanosine, T-thymine, C-cytosine, and U-uracil, and remember to label the 5' and 3' ends b) Next, write the sequence of a possible mRNA transcript of the double-stranded DNA above. Remember that an mRNA must be translatable by a ribosome into a protein. Be sure to indicate 5' and 3' ends c) Using the genetic code at the end, translate your mRNA into the appropriate protein. Write the amino acid sequence of the protein using the single letter amino acid code (also at the end) below the mRNA sequence in (b) and label the amino and carboxy terminals d) Suppose the bracketed bold [a] were…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY