
Biology: Life on Earth with Physiology (11th Edition)
11th Edition
ISBN: 9780133923001
Author: Gerald Audesirk, Teresa Audesirk, Bruce E. Byers
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 3.6, Problem 3CYL
Summary Introduction
To explain:
The importance of cholesterol in the body.
Introduction:
Cholesterol is the very important molecule of the body as it serves as a precursor of many molecules and hormones. It is lipid in nature and it is the reason of its insolubility. Cholesterol travels with the blood in the form of very minute particles, surrounded by proteins and hydrophilic phospholipids. This combination is called the lipoprotein.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 3 Solutions
Biology: Life on Earth with Physiology (11th Edition)
Ch. 3.1 - define organic molecules and explain why carbon is...Ch. 3.1 - which of these is/are polar molecules? (you may...Ch. 3.1 - explain why functional groups are important in...Ch. 3.1 - name and describe the properties of seven...Ch. 3.2 - define organic molecules and explain why carbon is...Ch. 3.3 - describe the major types of carbohydrates?Ch. 3.3 - A 19-year old 6' 2' male weighing 297 pounds comes...Ch. 3.3 - Describe hydrolysis of this molecule.Ch. 3.3 - provide examples of each type of carbohydrate and...Ch. 3.4 - Infectious prions such as those that cause mad cow...
Ch. 3.4 - describe protein subunits and how proteins are...Ch. 3.4 - Look up the rest of the amino acids and. based on...Ch. 3.4 - explain the four levels of protein structure and...Ch. 3.4 - Why do many proteins, when heated excessively....Ch. 3.4 - list several functions of proteins and provide...Ch. 3.4 - describe the properties of Intrinsically...Ch. 3.5 - Puzzling Proteins All cells use DNA as a blueprint...Ch. 3.5 - describe the general structure of nucleotides?Ch. 3.5 - Why a Perm Is (Temporarily) Permanent?Ch. 3.5 - list three different functions of nucleotides?Ch. 3.5 - explain how nucleic acids are synthesized?Ch. 3.5 - give two examples of nucleic acids and their...Ch. 3.6 - Prob. 1CSRCh. 3.6 - FIGURE 3-22 Synthesis of a triglyceride...Ch. 3.6 - compare and contrast the structure and synthesis...Ch. 3.6 - An obese 55-year-old woman consults her physician...Ch. 3.6 - What kind of reaction breaks this molecule apart?Ch. 3.6 - why are steroid hormones able to diffuse through...Ch. 3.6 - describe the functions of fats, oils, and waxes?Ch. 3.6 - Why are steroid hormones able to diffuse through...Ch. 3.6 - Prob. 3CYLCh. 3 - Based on their structure, sketch and explain how...Ch. 3 - In organic molecules made of chains of subunits,...Ch. 3 - Polar molecules a. dissolve in lipids. b. are...Ch. 3 - Prob. 1RQCh. 3 - Prob. 2ACCh. 3 - Prob. 2FIBCh. 3 - Prob. 2MCCh. 3 - List the four principal classes of biological...Ch. 3 - Prob. 3ACCh. 3 - Prob. 3FIBCh. 3 - Prob. 3MCCh. 3 - Prob. 3RQCh. 3 - Prob. 4FIBCh. 3 - Which of the following is not composed of...Ch. 3 - Prob. 4RQCh. 3 - Fill in the following with the appropriate type of...Ch. 3 - Prob. 5MCCh. 3 - Prob. 5RQCh. 3 - Describe the synthesis of a protein from amino...Ch. 3 - Where in nature do we find cellulose? Where do we...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning


Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College