Biology: Life on Earth with Physiology (11th Edition)
Biology: Life on Earth with Physiology (11th Edition)
11th Edition
ISBN: 9780133923001
Author: Gerald Audesirk, Teresa Audesirk, Bruce E. Byers
Publisher: PEARSON
bartleby

Concept explainers

Question
Book Icon
Chapter 3.6, Problem 3CYL
Summary Introduction

To explain:

The importance of cholesterol in the body.

Introduction:

Cholesterol is the very important molecule of the body as it serves as a precursor of many molecules and hormones. It is lipid in nature and it is the reason of its insolubility. Cholesterol travels with the blood in the form of very minute particles, surrounded by proteins and hydrophilic phospholipids. This combination is called the lipoprotein.

Blurred answer
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?

Chapter 3 Solutions

Biology: Life on Earth with Physiology (11th Edition)

Ch. 3.4 - describe protein subunits and how proteins are...Ch. 3.4 - Look up the rest of the amino acids and. based on...Ch. 3.4 - explain the four levels of protein structure and...Ch. 3.4 - Why do many proteins, when heated excessively....Ch. 3.4 - list several functions of proteins and provide...Ch. 3.4 - describe the properties of Intrinsically...Ch. 3.5 - Puzzling Proteins All cells use DNA as a blueprint...Ch. 3.5 - describe the general structure of nucleotides?Ch. 3.5 - Why a Perm Is (Temporarily) Permanent?Ch. 3.5 - list three different functions of nucleotides?Ch. 3.5 - explain how nucleic acids are synthesized?Ch. 3.5 - give two examples of nucleic acids and their...Ch. 3.6 - Prob. 1CSRCh. 3.6 - FIGURE 3-22 Synthesis of a triglyceride...Ch. 3.6 - compare and contrast the structure and synthesis...Ch. 3.6 - An obese 55-year-old woman consults her physician...Ch. 3.6 - What kind of reaction breaks this molecule apart?Ch. 3.6 - why are steroid hormones able to diffuse through...Ch. 3.6 - describe the functions of fats, oils, and waxes?Ch. 3.6 - Why are steroid hormones able to diffuse through...Ch. 3.6 - Prob. 3CYLCh. 3 - Based on their structure, sketch and explain how...Ch. 3 - In organic molecules made of chains of subunits,...Ch. 3 - Polar molecules a. dissolve in lipids. b. are...Ch. 3 - Prob. 1RQCh. 3 - Prob. 2ACCh. 3 - Prob. 2FIBCh. 3 - Prob. 2MCCh. 3 - List the four principal classes of biological...Ch. 3 - Prob. 3ACCh. 3 - Prob. 3FIBCh. 3 - Prob. 3MCCh. 3 - Prob. 3RQCh. 3 - Prob. 4FIBCh. 3 - Which of the following is not composed of...Ch. 3 - Prob. 4RQCh. 3 - Fill in the following with the appropriate type of...Ch. 3 - Prob. 5MCCh. 3 - Prob. 5RQCh. 3 - Describe the synthesis of a protein from amino...Ch. 3 - Where in nature do we find cellulose? Where do we...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Basic Clinical Laboratory Techniques 6E
Biology
ISBN:9781133893943
Author:ESTRIDGE
Publisher:Cengage
Text book image
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Biology
ISBN:9781305967359
Author:STARR
Publisher:CENGAGE L
Text book image
Aquaculture Science
Biology
ISBN:9781133558347
Author:Parker
Publisher:Cengage
Text book image
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Text book image
Curren'S Math For Meds: Dosages & Sol
Nursing
ISBN:9781305143531
Author:CURREN
Publisher:Cengage