Brock Biology of Microorganisms (14th Edition)
14th Edition
ISBN: 9780321897398
Author: Michael T. Madigan, John M. Martinko, Kelly S. Bender, Daniel H. Buckley, David A. Stahl, Thomas Brock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 3.4, Problem 1MQ
What is free energy?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 3 Solutions
Brock Biology of Microorganisms (14th Edition)
Ch. 3.1 - Which four chemical elements make up the bulk of a...Ch. 3.1 - Which two classes of macromolecules contain most...Ch. 3.1 - Prob. 3MQCh. 3.2 - Why would a complex culture medium for Leuconostoc...Ch. 3.2 - In which medium shown in Table 5.1, defined or...Ch. 3.2 - What is meant by the word sterile? Why is aseptic...Ch. 3.3 - Prob. 1MQCh. 3.3 - Prob. 2MQCh. 3.4 - What is free energy?Ch. 3.4 - Prob. 2MQ
Ch. 3.4 - Using Table 3.2, calculate G0 for the reaction...Ch. 3.5 - Prob. 1MQCh. 3.5 - Prob. 2MQCh. 3.5 - Prob. 3MQCh. 3.6 - Prob. 1MQCh. 3.6 - Prob. 2MQCh. 3.6 - Prob. 3MQCh. 3.7 - How much free energy is released when ATP is...Ch. 3.7 - Prob. 2MQCh. 3.7 - Prob. 3MQCh. 3.8 - Which reactions in glycolysis are redox steps?Ch. 3.8 - Prob. 2MQCh. 3.8 - Prob. 3MQCh. 3.9 - Prob. 1MQCh. 3.9 - Prob. 2MQCh. 3.10 - Prob. 1MQCh. 3.10 - Which electron carriers described in this section...Ch. 3.11 - How do electron transport reactions generate the...Ch. 3.11 - Prob. 2MQCh. 3.11 - What structure in the cell links the proton motive...Ch. 3.12 - Prob. 1MQCh. 3.12 - What two major roles do the citric acid cycle and...Ch. 3.12 - Why is the glyoxylate cycle necessary for growth...Ch. 3.13 - Prob. 1MQCh. 3.13 - Prob. 2MQCh. 3.13 - Prob. 3MQCh. 3.14 - What form of activated glucose is used in the...Ch. 3.14 - Prob. 2MQCh. 3.14 - What functions does the pentose phosphate pathway...Ch. 3.15 - Prob. 1MQCh. 3.15 - List the steps required for the cell to...Ch. 3.15 - Which nitrogen bases are purines and which are...Ch. 3.16 - Prob. 1MQCh. 3.16 - Prob. 2MQCh. 3.17 - Prob. 1MQCh. 3.17 - Prob. 2MQCh. 3.17 - Prob. 3MQCh. 3 - Prob. 1RQCh. 3 - Prob. 2RQCh. 3 - What is aseptic technique and why is it necessary?...Ch. 3 - Prob. 4RQCh. 3 - REVIEW QUESTIONS
5. Describe how you would...Ch. 3 - Prob. 6RQCh. 3 - Why are enzymes needed by the cell? (Section 3.5)
Ch. 3 - Prob. 8RQCh. 3 - 9. What is the reduction potential of the...Ch. 3 - Prob. 10RQCh. 3 - How is ATP made in fermentation and in...Ch. 3 - Prob. 12RQCh. 3 - MINIQUIZ
13. Besides lactic acid and ethanol, list...Ch. 3 - List some of the key electron carriers found in...Ch. 3 - What is meant by proton motive force and how is it...Ch. 3 - Prob. 16RQCh. 3 - MINIQUIZ
17. How much more ATP is possible in...Ch. 3 - Prob. 18RQCh. 3 - MINIQUIZ
19. What is the major difference between...Ch. 3 - Prob. 20RQCh. 3 - Describe the process by which a fatty acid such as...Ch. 3 - Prob. 22RQCh. 3 - Prob. 1AQCh. 3 - Application Questions
2. Desulfovibrio can grow...Ch. 3 - Using the data of Figure 3.10, predict the...Ch. 3 - Prob. 4AQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Enzyme Kinetics; Author: MIT OpenCourseWare;https://www.youtube.com/watch?v=FXWZr3mscUo;License: Standard Youtube License