
Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 32.4, Problem 1MQ
How is legionellosis transmitted?
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
Chapter 32 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 32.1 - What is potable water?Ch. 32.1 - Prob. 2MQCh. 32.1 - Prob. 1CRCh. 32.2 - Why is Escherichia coli used as an indicator...Ch. 32.2 - What procedures are used to ensure the safety of...Ch. 32.2 - Prob. 1CRCh. 32.3 - What organism causes cholera, and what are the...Ch. 32.3 - Prob. 2MQCh. 32.3 - Prob. 3MQCh. 32.3 - Why are antibiotics ineffective for the treatment...
Ch. 32.4 - How is legionellosis transmitted?Ch. 32.4 - Identify specific measures for control of...Ch. 32.4 - Prob. 1CRCh. 32.5 - Contrast the causative agents of typhoid and noro...Ch. 32.5 - Prob. 2MQCh. 32.5 - Prob. 1CRCh. 32.6 - List the major food groups as categorized by their...Ch. 32.6 - Identify physical and chemical methods used for...Ch. 32.6 - List some dairy, meat, beverage, and vegetable...Ch. 32.6 - Prob. 1CRCh. 32.7 - Prob. 1MQCh. 32.7 - Describe microbial sampling procedures for solid...Ch. 32.7 - Prob. 3MQCh. 32.7 - Prob. 1CRCh. 32.8 - Identify the symptoms and mechanism of...Ch. 32.8 - Prob. 2MQCh. 32.8 - Staphylococcal food poisoning results from the...Ch. 32.9 - Prob. 1MQCh. 32.9 - Prob. 2MQCh. 32.9 - Clostridium food poisoning results from ingestion...Ch. 32.10 - Describe salmonellosis food infection. How does a...Ch. 32.10 - Prob. 2MQCh. 32.10 - Prob. 1CRCh. 32.11 - How do STEC strains of Escherichia coli differ...Ch. 32.11 - Why are meats prime vehicles for pathogenic E....Ch. 32.11 - Toxigenic Escherichia coli cause many food...Ch. 32.12 - Describe the pathology of Campylobacter food...Ch. 32.12 - Prob. 2MQCh. 32.12 - Prob. 1CRCh. 32.13 - Prob. 1MQCh. 32.13 - Prob. 2MQCh. 32.13 - Prob. 1CRCh. 32.14 - In what two forms can Bacillus cereus food...Ch. 32.14 - Compared with all other foodborne or waterborne...Ch. 32.14 - Prob. 1CRCh. 32 - As a visitor to a country in which cholera is an...Ch. 32 - Prob. 2AQCh. 32 - Prob. 3AQ
Additional Science Textbook Solutions
Find more solutions based on key concepts
How does the removal of hydrogen atoms from nutrient molecules result in a loss of energy from the nutrient mol...
SEELEY'S ANATOMY+PHYSIOLOGY
Describe the role and impact of microbes on the earth.
Microbiology Fundamentals: A Clinical Approach
On what molecule does the anticodon appear? Explain the role of this molecule in protein synthesis.
Human Physiology: An Integrated Approach (8th Edition)
Single penny tossed 20 times and counting heads and tails: Probability (prediction): _______/20 heads ________/...
Laboratory Manual For Human Anatomy & Physiology
45. Calculate the mass of nitrogen dissolved at room temperature in an 80.0-L home aquarium. Assume a total pre...
Chemistry: Structure and Properties (2nd Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Case Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:CengageBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Infectious Diseases - How do we control them?; Author: Let's Learn Public Health;https://www.youtube.com/watch?v=2JWku3Kjpq0;License: Standard Youtube License