Biology: Life on Earth
10th Edition
ISBN: 9780321729712
Author: Gerald Audesirk, Teresa Audesirk, Bruce E. Byers
Publisher: Benjamin Cummings
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 3, Problem 5AC
In an alternate universe where people could digest cellulose molecules, how might this affect our way of life?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Many vegetables are “blanched” (dropped into boiling water) for a few minutes before being frozen. Why is blanching necessary?
Why does a cell store carbohydrate as starch rather than glucose ?
A certain molecule will not dissolve in water and has a structure consisting of glycerol covalently bound
to three fatty acid tails.
What is the function of this molecule?
A:Genetic information storage
B:Cell communication
C:Catalysis of chemical reactions
D:Energy storage
Chapter 3 Solutions
Biology: Life on Earth
Ch. 3 - Fill-in-the-Blank In organic molecules made of...Ch. 3 - 5. Fill in the following with the appropriate type...Ch. 3 - Fill-in-the-Blank Proteins are synthesized by a...Ch. 3 - Fill-in-the-Blank Till in the following with the...Ch. 3 - Fill-in-the-Blank A nucleotide consists of three...Ch. 3 - Prob. 1RQCh. 3 - List the four principal classes of biological...Ch. 3 - What roles do nucleotides play in living...Ch. 3 - Prob. 4RQCh. 3 - Prob. 5RQ
Ch. 3 - Prob. 6RQCh. 3 - Describe the synthesis of a protein from amino...Ch. 3 - Where in nature do we find cellulose? Where do we...Ch. 3 - Which kinds of bonds between keratin molecules are...Ch. 3 - In this chapter, you read that a phospholipid has...Ch. 3 - Prob. 2ACCh. 3 - Some people think that consuming fat and sugar...Ch. 3 - Saliva from infected deer can transmit chronic...Ch. 3 - In an alternate universe where people could digest...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Disaccharides like lactose can barely get through dialysis tubing, but CAN NOT move across a cell membrane. Therefore, what must happen to disaccharides and polysaccharides that we eat in order for our cells to use them as energy molecules?arrow_forwardWhich one of the following is an enzyme? Question 3 options: A) glucose B) cholesterol C) phospholipid D) β-galactosidasearrow_forwardResearchers investigated whether the body recognizes sucralose as a carbohydrate. They began by feeding sucralose labeled with 14C to volunteers. Analysis of the radioactive molecules in the volunteers’ urine and feces showed that 92.8 percent of the sucralose passed through the body without being altered. Many people are worried that the chlorine atoms impart toxicity to sucralose. How would you respond to that concern?arrow_forward
- Whenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?arrow_forwardHello, Can someone please explain this question to me? I really try to understand to solve it but i struggle. Any help is appreciatedarrow_forwardMany of the proteins produced in the endoplasmic reticulum undergo modifications such as the addition of carbohydrates (oligosaccharides). What is the role of these sugars in such proteins?arrow_forward
- When simple monosaccharides are linked together into larger oligosaccharides by the process of dehydration synthesis, what other molecule is created?arrow_forwardWhy does it make good sense to have a single nucleotide, ATP, function as the cellular energy currency?arrow_forward"All the glycoproteins and glycolipids in intracellular membranes have oligosaccharide chains facing the luminal side, and all those in the plasma membrane have oligosaccharide chains facing the outside of the cell" is true or false.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Microbial Nutrition and Growth; Author: Scientist Cindy;https://www.youtube.com/watch?v=rK3UkyWjkl8;License: Standard YouTube License, CC-BY