
Concept explainers
Introduction:
In an ecosystem, the effects of abiotic factors are very important for the survival of species. The limiting factors are the abiotic factors that may limit the growth of population after a certain number. Tolerance factor is the measurement of the range in which a particular organism can easily survive.

Answer to Problem 4A
Correct Answer:
Option (c) Limiting factor.
Explanation of Solution
Explanation/justification for the correct answer:
Option (c) limiting factor. The limiting factor is the abiotic factor that limits the growth or the survival of the organism after a certain number. In this case, where the amount of iron determines the
Explanation for incorrect answer:
Option (a) distribution. The distribution factors can be described as the factor affecting the presence or absence of an organism in an ecosystem. Most of the organism prefer to live in the region, where
Option (b) tolerance. The tolerance factor measures the range of an abiotic factor that can be tolerated by the organism. All the organism if present in a intolerable zone, they would die, it does not control the population. Hence, this is an incorrect option.
Option (d) biotic. The biotic factors are the living things affecting the survivability of the organism. Here, iron is not a biotic factor. Hence, this is an incorrect option.
Chapter 3 Solutions
Glencoe Biology: Indiana Edition
Additional Science Textbook Solutions
Campbell Essential Biology (7th Edition)
Anatomy & Physiology (6th Edition)
Campbell Biology (11th Edition)
Chemistry: Structure and Properties (2nd Edition)
Applications and Investigations in Earth Science (9th Edition)
Human Physiology: An Integrated Approach (8th Edition)
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





