Glencoe Biology: Indiana Edition
12th Edition
ISBN: 9780078961588
Author: Alton Biggs, Whitney Crispen Hagins, William G. Holliday, Chris L. Kapicka, Linda Lundgren
Publisher: Glencoe/McGraw-Hill School Pub
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 3, Problem 27A
Summary Introduction
To describe:
The region in the sea where photosynthetic organism live.
Introduction:
There are different zones of the sea. In general, hey are of three types loiter zone, open sea (photic) and deep sea (aphotic) zone.
Expert Solution & Answer
Explanation of Solution
The open sea or the photic zone is the region where the sunlight is present. The photosynthetic organism need sunlight in order to perform the process of photo synthesis. Deep sea is devoid of light. So, the photic zone or the open sea is the region where photosynthetic organism live.
Chapter 3 Solutions
Glencoe Biology: Indiana Edition
Ch. 3 - Prob. 1ACh. 3 - Prob. 2ACh. 3 - Prob. 3ACh. 3 - Prob. 4ACh. 3 - Prob. 5ACh. 3 - Prob. 6ACh. 3 - Prob. 7ACh. 3 - Prob. 8ACh. 3 - Prob. 9ACh. 3 - Prob. 10A
Ch. 3 - Prob. 11ACh. 3 - Prob. 12ACh. 3 - Prob. 13ACh. 3 - Prob. 14ACh. 3 - Prob. 15ACh. 3 - Prob. 16ACh. 3 - Prob. 17ACh. 3 - Prob. 18ACh. 3 - Prob. 19ACh. 3 - Prob. 20ACh. 3 - Prob. 21ACh. 3 - Prob. 22ACh. 3 - Prob. 23ACh. 3 - Prob. 24ACh. 3 - Prob. 25ACh. 3 - Prob. 26ACh. 3 - Prob. 27ACh. 3 - Prob. 28ACh. 3 - Prob. 29ACh. 3 - Prob. 30ACh. 3 - Prob. 31ACh. 3 - Prob. 32ACh. 3 - Prob. 33ACh. 3 - Prob. 34ACh. 3 - Prob. 35ACh. 3 - Prob. 36ACh. 3 - Prob. 37ACh. 3 - Prob. 38ACh. 3 - Prob. 39ACh. 3 - Prob. 40ACh. 3 - Prob. 1STPCh. 3 - Prob. 2STPCh. 3 - Prob. 3STPCh. 3 - Prob. 4STPCh. 3 - Prob. 5STPCh. 3 - Prob. 6STPCh. 3 - Prob. 7STPCh. 3 - Prob. 8STPCh. 3 - Prob. 9STPCh. 3 - Prob. 10STPCh. 3 - Prob. 11STPCh. 3 - Prob. 12STPCh. 3 - Prob. 13STPCh. 3 - Prob. 14STPCh. 3 - Prob. 15STPCh. 3 - Prob. 16STPCh. 3 - Prob. 17STPCh. 3 - Prob. 18STPCh. 3 - Prob. 19STP
Additional Science Textbook Solutions
Find more solutions based on key concepts
1. An object is subject to two forces that do not point in opposite directions. Is it possible to choose their ...
College Physics: A Strategic Approach (3rd Edition)
What two body structures contain flexible elastic cartilage?
Anatomy & Physiology (6th Edition)
1. Why is the quantum-mechanical model of the atom important for understanding chemistry?
Chemistry: Structure and Properties (2nd Edition)
Why is an endospore called a resting structure? Of what advantage is an endospore to a bacterial cell?
Microbiology: An Introduction
What percentage of Earths land surface do glaciers presently cover? ____________
Applications and Investigations in Earth Science (9th Edition)
Explain why genetic Variation within a population is a prerequisite for evolution.
Campbell Biology (11th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
The Evolution of Populations: Natural Selection, Genetic Drift, and Gene Flow; Author: Professor Dave Explains;https://www.youtube.com/watch?v=SRWXEMlI0_U;License: Standard YouTube License, CC-BY
The Evolution of Humans | Evolution | Biology | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=Vf_dDp7drFg;License: Standard YouTube License, CC-BY