Glencoe Biology: Indiana Edition
12th Edition
ISBN: 9780078961588
Author: Alton Biggs, Whitney Crispen Hagins, William G. Holliday, Chris L. Kapicka, Linda Lundgren
Publisher: Glencoe/McGraw-Hill School Pub
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 3, Problem 29A
Summary Introduction
Introduction:
The water is one of the essential elements in our body and it plays a very important role in survival.
Expert Solution & Answer
Answer to Problem 29A
Correct Answer:
Option (C) Oceans.
Explanation of Solution
Explanation/justification for the correct answer:
Option (C) oceans. Oceans have almost 96.5% water present on earth. Hence largest percent of water is located in oceans.
Explanation for incorrect answer:
Option (A) ground water. Ground water is only 1.7 percent of total water. Hence, it is an incorrect answer.
Option (B) River. River water is only 0.7 percent of total water. Hence, it is an incorrect answer.
Option (D) Glaciers. Glaciers and snow have 1.75 percent of total water. Hence, it is an incorrect answer.
Chapter 3 Solutions
Glencoe Biology: Indiana Edition
Ch. 3 - Prob. 1ACh. 3 - Prob. 2ACh. 3 - Prob. 3ACh. 3 - Prob. 4ACh. 3 - Prob. 5ACh. 3 - Prob. 6ACh. 3 - Prob. 7ACh. 3 - Prob. 8ACh. 3 - Prob. 9ACh. 3 - Prob. 10A
Ch. 3 - Prob. 11ACh. 3 - Prob. 12ACh. 3 - Prob. 13ACh. 3 - Prob. 14ACh. 3 - Prob. 15ACh. 3 - Prob. 16ACh. 3 - Prob. 17ACh. 3 - Prob. 18ACh. 3 - Prob. 19ACh. 3 - Prob. 20ACh. 3 - Prob. 21ACh. 3 - Prob. 22ACh. 3 - Prob. 23ACh. 3 - Prob. 24ACh. 3 - Prob. 25ACh. 3 - Prob. 26ACh. 3 - Prob. 27ACh. 3 - Prob. 28ACh. 3 - Prob. 29ACh. 3 - Prob. 30ACh. 3 - Prob. 31ACh. 3 - Prob. 32ACh. 3 - Prob. 33ACh. 3 - Prob. 34ACh. 3 - Prob. 35ACh. 3 - Prob. 36ACh. 3 - Prob. 37ACh. 3 - Prob. 38ACh. 3 - Prob. 39ACh. 3 - Prob. 40ACh. 3 - Prob. 1STPCh. 3 - Prob. 2STPCh. 3 - Prob. 3STPCh. 3 - Prob. 4STPCh. 3 - Prob. 5STPCh. 3 - Prob. 6STPCh. 3 - Prob. 7STPCh. 3 - Prob. 8STPCh. 3 - Prob. 9STPCh. 3 - Prob. 10STPCh. 3 - Prob. 11STPCh. 3 - Prob. 12STPCh. 3 - Prob. 13STPCh. 3 - Prob. 14STPCh. 3 - Prob. 15STPCh. 3 - Prob. 16STPCh. 3 - Prob. 17STPCh. 3 - Prob. 18STPCh. 3 - Prob. 19STP
Additional Science Textbook Solutions
Find more solutions based on key concepts
26. A 10 kg crate is placed on a horizontal conveyor belt. The materials are such that and .
a. Draw a free-...
Physics for Scientists and Engineers: A Strategic Approach, Vol. 1 (Chs 1-21) (4th Edition)
Where is transitional epithelium found and what is its importance at those sites?
Anatomy & Physiology (6th Edition)
Why is an endospore called a resting structure? Of what advantage is an endospore to a bacterial cell?
Microbiology: An Introduction
[14.110] The following mechanism has been proposed for the gas-phase reaction of chloroform (CHCI3) and chlorin...
Chemistry: The Central Science (14th Edition)
10.71 Identify each of the following as an acid or a base: (10.1)
H2SO4
RbOH
Ca(OH)2
HI
...
Chemistry: An Introduction to General, Organic, and Biological Chemistry (13th Edition)
15. A good scientific hypothesis is based on existing evidence and leads to testable predictions. What hypothes...
Campbell Biology: Concepts & Connections (9th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
6th Grade Science - Module 2: Physical & Chemical Properties; Author: iUniversity Prep;https://www.youtube.com/watch?v=4DONkU6c2Rs;License: Standard youtube license