Concept explainers
To determine: The sequences of the mature RNA.
Concept introduction: The sequence of the three mRNA
Given: The sequence of the sense strand of a mammalian gene is as follows:
TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATTAATTAAGCACAGGCATGCAGGGATATCCTCCAAAAAGGTAAGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATAAACGATATCGATCGGTTAGGTAAGTCTGAT
Assume that: The transcription initiates at a G, which is approximately 25bp downstream of the TATAATA sequence, in which each 5′ splice site has the sequence AG/GUAAGU, and that each 3′ splice site has the sequence CAG/G, where / marks the location of the splice.
To determine: The sequences of encoded protein.
Concept introduction: The sequence of the three mRNA nucleotides that codes for the amino acids during the translation process is called codon. Three nucleotides constitute a codon that codes for the single amino acid. The codon where the translation process initiates is the start codon, which is usually AUG that codes for methionine. The stop codon terminates the translation process. The stop codons are UAA, UGA, and UAG.
Given: The sequence of the sense strand of a mammalian gene is as follows:
TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATTAATTAAGCACAGGCATGCAGGGATATCCTCCAAAAAGGTAAGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATAAACGATATCGATCGGTTAGGTAAGTCTGAT
Assume that: The transcription initiates at a G, which is approximately 25bp downstream of the TATAATA sequence, in which each 5′ splice site has the sequence AG/GUAAGU, and that each 3′ splice site has the sequence CAG/G, where / marks the location of the splice.
Trending nowThis is a popular solution!
Chapter 27 Solutions
FUNDAMENTALS OF BIOCHEMISTRY WPNG 1-SEME
- Calculate the standard change in Gibbs free energy, AGrxn, for the given reaction at 25.0 °C. Consult the table of thermodynamic properties for standard Gibbs free energy of formation values. NH,Cl(s) →NH; (aq) + C1 (aq) AGrxn -7.67 Correct Answer Determine the concentration of NH+ (aq) if the change in Gibbs free energy, AGrxn, for the reaction is -9.27 kJ/mol. 6.49 [NH+] Incorrect Answer kJ/mol Marrow_forwardWhat are some topics of interest that neurotoxicologists study? For example, toxin-induced seizures, brain death, and such along those lines?arrow_forwardCould you help me with the explanation of the answer to exercise 15, chapter 1 of Lehinger Question Nombramiento de estereoisómeros con dos carbonos quirales utilizando el sistema RS(R,R)El isómero del metilfenidato (Ritalin) se utiliza para tratar el trastorno por déficit de atención con hiperactividad (TDAH).(S,S)El isómero es un antidepresivo. Identifique los dos carbonos quirales en la siguiente estructura. ¿Es este el(R,R)o el(S,S)¿isómero? Dibuja el otro isómero. Nombramiento de estereoisómeros con dos carbonos quirales utilizando el sistema RS(R,R)El isómero del metilfenidato (Ritalin) se utiliza para tratar el trastorno por déficit de atención con hiperactividad (TDAH).(S,S)El isómero es un antidepresivo.arrow_forward
- The reaction A+B → C + D AG°' = -7.3 kcal/mol can be coupled with which of the following unfavorable reactions to drive it forward? A. EFG+HAG° = 5.6 kcal/mol. B. J+KZ+A AG° = 2.3 kcal/mol. C. P+RY+DAG° = 8.2 kcal/mol. D. C + T → V + W AG°' = -5.9 kcal/mol. E. AN→ Q+KAG°' = 4.3 kcal/mol.arrow_forwardWhat would be the toxicological endpoints for neurotoxicity?arrow_forwardWhat are "endpoints" in toxicology exactly? Please give an intuitive easy explanationarrow_forward
- Fura-2 Fluorescence (Arbitrary Unit) 4500 4000 3500 3000 2500 2000 1500 1000 500 [Ca2+]=2970nM, 25°C [Ca2+] 2970nM, 4°C [Ca2+]=0.9nM, 25°C [Ca2+] = 0.9nM, 4°C 0 260 280 300 340 360 380 400 420 440 Wavelength (nm) ← < The figure on the LHS shows the excitation spectra of Fura-2 (Em = 510 nm) in 2 solutions with two different Ca2+ ion concentration as indicated. Except for temperature, the setting for excitation & signal acquisition was identical.< ப a) The unit in Y-axis is arbitrary (unspecified). Why? < < b) Compare & contrast the excitation wavelength of the Isosbestic Point of Fura-2 at 25 °C & 4 °C. Give a possible reason for the discrepancy. < c) The fluorescence intensity at 25 °C & 4 °C are different. Explain why with the concept of electronic configuration. <arrow_forwarddraw in the structure of each amino acid (as L-amino acids) using the Fischer projection style. an example has been included. Draw the structure for glycine, alanine, valine, isoleucine, methionine, proline, phenylalanine, tryptophan, serine, threonine, asparagine, glutamine, lysine, arginine, aspartic acid, glutamic acid, histidine, tyrosine, cysteinearrow_forwarddraw in the structure of each amino acid (as L-amino acids) using the Fischer projection style. an example has been includedarrow_forward
- draw in the structure of each amino acid (as L-amino acids) using the Fischer projection style. an example has been includedarrow_forwardDraw out the following peptide H-R-K-E-D at physiological pH (~7.4). Make sure toreference table 3.1 for pKa values.arrow_forwardThe table provides the standard reduction potential, E', for relevant half-cell reactions. Half-reaction E'° (V) Oxaloacetate² + 2H+ + 2e malate²- -0.166 Pyruvate + 2H+ + 2e → lactate -0.185 Acetaldehyde + 2H+ + 2e¯ →→→ ethanol -0.197 NAD+ + H+ + 2e--> NADH -0.320 NADP+ + H+ + 2e →→ NADPH Acetoacetate + 2H+ + 2e¯ - -0.324 B-hydroxybutyrate -0.346 Which of the reactions listed would proceed in the direction shown, under standard conditions, in the presence of the appropriate enzymes? Malate + NAD+ oxaloacetate + NADH + H+ Malate + pyruvate oxaloacetate + lactate Pyruvate + NADH + H+ lactate + NAD+ Pyruvate + p-hydroxybutyrate lactate + acetoacetate Acetaldehyde + succinate ethanol + fumerate Acetoacetate + NADH + H+ → B-hydroxybutyrate + NAD+arrow_forward
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON