Concept explainers
(a)
To identify: The DNA sequence for the given sequence that encodes peptides of vir-1 and vir-2.
Concept introduction: Protein molecules are the essential nutrients of the body. Proteins are synthesized in the ribosomes of the cell. Transcription is the process of the production of mRNA from the DNA molecules. mRNA sequences carry the information from one generation to another. Translation is the process of synthesizing protein molecules.
Given: AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT.
(b)
To determine: The amino acid sequence for the peptides of vir-1 and vir-2.
Concept introduction: Protein molecules are the essential nutrients of the body. Proteins are synthesized in the ribosomes of the cell. Transcription is the process of the production of mRNA from the DNA molecules. mRNA sequences carry the information from one generation to another. Translation is the process of synthesizing protein molecules.
Given: AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT.
(c)
To determine: The amino acid sequence for the peptides of vir-1 and vir-2 that are encoded by mutant viruses where T, at position 23, is replaced by G.
Concept introduction: The protein molecules are the essential nutrients of the body. Proteins are synthesized in the ribosomes of the cell. Transcription is the process of the production of mRNA from the DNA molecules. mRNA sequences carry the information from one generation to another. Translation is the process of synthesizing protein molecules.
Given: AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT.
Want to see the full answer?
Check out a sample textbook solutionChapter 27 Solutions
FUNDAMENTALS OF BIOCHEMISTRY WPNG 1-SEME
- Draw the predominant form of glutamic acid at pH = 8.4. The pKa of the side chain is 4.1. Include proper stereochemistry. HO H2N OH pH = 8.4arrow_forwardHow would I draw this?arrow_forwardCalculate the standard change in Gibbs free energy, AGrxn, for the given reaction at 25.0 °C. Consult the table of thermodynamic properties for standard Gibbs free energy of formation values. NH,Cl(s) →NH; (aq) + C1 (aq) AGrxn -7.67 Correct Answer Determine the concentration of NH+ (aq) if the change in Gibbs free energy, AGrxn, for the reaction is -9.27 kJ/mol. 6.49 [NH+] Incorrect Answer kJ/mol Marrow_forward
- What are some topics of interest that neurotoxicologists study? For example, toxin-induced seizures, brain death, and such along those lines?arrow_forwardCould you help me with the explanation of the answer to exercise 15, chapter 1 of Lehinger Question Nombramiento de estereoisómeros con dos carbonos quirales utilizando el sistema RS(R,R)El isómero del metilfenidato (Ritalin) se utiliza para tratar el trastorno por déficit de atención con hiperactividad (TDAH).(S,S)El isómero es un antidepresivo. Identifique los dos carbonos quirales en la siguiente estructura. ¿Es este el(R,R)o el(S,S)¿isómero? Dibuja el otro isómero. Nombramiento de estereoisómeros con dos carbonos quirales utilizando el sistema RS(R,R)El isómero del metilfenidato (Ritalin) se utiliza para tratar el trastorno por déficit de atención con hiperactividad (TDAH).(S,S)El isómero es un antidepresivo.arrow_forwardThe reaction A+B → C + D AG°' = -7.3 kcal/mol can be coupled with which of the following unfavorable reactions to drive it forward? A. EFG+HAG° = 5.6 kcal/mol. B. J+KZ+A AG° = 2.3 kcal/mol. C. P+RY+DAG° = 8.2 kcal/mol. D. C + T → V + W AG°' = -5.9 kcal/mol. E. AN→ Q+KAG°' = 4.3 kcal/mol.arrow_forward
- What would be the toxicological endpoints for neurotoxicity?arrow_forwardWhat are "endpoints" in toxicology exactly? Please give an intuitive easy explanationarrow_forwardFura-2 Fluorescence (Arbitrary Unit) 4500 4000 3500 3000 2500 2000 1500 1000 500 [Ca2+]=2970nM, 25°C [Ca2+] 2970nM, 4°C [Ca2+]=0.9nM, 25°C [Ca2+] = 0.9nM, 4°C 0 260 280 300 340 360 380 400 420 440 Wavelength (nm) ← < The figure on the LHS shows the excitation spectra of Fura-2 (Em = 510 nm) in 2 solutions with two different Ca2+ ion concentration as indicated. Except for temperature, the setting for excitation & signal acquisition was identical.< ப a) The unit in Y-axis is arbitrary (unspecified). Why? < < b) Compare & contrast the excitation wavelength of the Isosbestic Point of Fura-2 at 25 °C & 4 °C. Give a possible reason for the discrepancy. < c) The fluorescence intensity at 25 °C & 4 °C are different. Explain why with the concept of electronic configuration. <arrow_forward
- draw in the structure of each amino acid (as L-amino acids) using the Fischer projection style. an example has been included. Draw the structure for glycine, alanine, valine, isoleucine, methionine, proline, phenylalanine, tryptophan, serine, threonine, asparagine, glutamine, lysine, arginine, aspartic acid, glutamic acid, histidine, tyrosine, cysteinearrow_forwarddraw in the structure of each amino acid (as L-amino acids) using the Fischer projection style. an example has been includedarrow_forwarddraw in the structure of each amino acid (as L-amino acids) using the Fischer projection style. an example has been includedarrow_forward
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON