
Research a developing country (such as Nigeria, Afghanistan, or Uganda) with rapid population growth and find out what factors sustain that growth and why. Explain these factors and assess the likelihood that the fertility rate of this country will drop in the near future.

To determine:
The factors that sustain the rapid growth of developing countries like Nigeria, Afghanistan or Uganda.
Introduction:
The changes in a population number could be due to birth rate, death rate, immigration, and emigration. Birth and immigration lead to add individuals to a population and death and emigration leads to decrease in the number of individuals from a population. A wide gap between the birth and death rate could lead to faster growth in the rate of population.
Explanation of Solution
The population growth of developed countries is characterized by low death and birth rate. Increased food production, improved healthcare, and many other factors contributed to the low death rate. Also, the birth rate increased due to better economic conditions of people and access to birth control measures.
The factors that sustain the rapid growth of developing countries are listed below as:
1. Poverty: Poverty causes malnutrition which results in the increase of death rate. This will affect the population growth of developing countries.
2. Heath issues: Health issues affect the reproductive rates which directly affect the population growth of developing countries.
3. Politics: Politics also affect the population growth of developing countries, as the economy of developing country links to the political structures.
4. Terrorism: Terrorism also affects the population growth of developing countries.

To determine:
Explain the factors and assess the likelihood that the fertility rate of this country will drop in the near future.
Introduction:
The changes in a population number could be due to birth rate, death rate, immigration, and emigration. The factors which affect the population’s growth are poverty, health issues, and food production.
Explanation of Solution
The population growth of developed countries is characterized by low death and birth rate. There are many factors like poverty which cause malnutrition, health care issues, and so on; all these factors affect the birth rate of population. If these factors remain in developing countries then fertility rate of the developing countries will keep decreasing.
The factors that sustain the rapid growth of the countries are poverty, health issues, politics, and terrorism. These factors also affect the fertility rate which in turn affects the population growth.
Want to see more full solutions like this?
Chapter 27 Solutions
Biology: Life on Earth with Physiology (11th Edition)
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Essentials Health Info Management Principles/Prac...Health & NutritionISBN:9780357191651Author:BowiePublisher:CengageConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning


