To write:
List microorganisms cause genitourinary infections.
Given:
List of microorganisms which cause genitourinary infections.
Introduction:
Urinary tract infection is commonly caused by bacteria and occasionally caused by protozoa and
Genital infection is mostly caused by bacteria and other microorganisms, such as yeast and protozoan. They grow and cover the surface epithelial cells of the vagina. Bacterial vaginosis is a common reproductive tract infection in women, it can be transmitted through sexual contact. It causes ectopic pregnancy and infertility. The vaginal infection is characterized by genital itching and burning and pain during urination or sexual contact. It causes vaginal discharge with bad smell. Vaginal smear, serological test and PCR are used to diagnose genital infection. It can be treated with antibiotics and prevented by personal hygiene.
Want to see the full answer?
Check out a sample textbook solutionChapter 26 Solutions
Microbiology: An Introduction
- 18) What tissue samples the above slides were taken from?19) What is the name of the parasite patient 1 is infected with?20) What is the name of the vector for the patient 1 parasite? ** the information is located on the top**arrow_forwardPlease reply to the post below whether or not you agree or disagree and why A common microbe found in foods and can be taken orally are probiotics. Probiotics are live bacteria that balance good and bad intestinal bacteria and aid in digestion or digestive problems. For example, Lactobacillus species habituate where rich carbohydrate substances are available including the human digestive and urinary tracts. In 1900 lactobacillus acidophilus was isolated by Moro from infant feces and the intestinal tract of animals and humans. Also, it was reported in the feces of milk fed infants and older persons consuming high milk/lactose diets. This microbe is also found in plant materials and agricultural products particularly milk, cheese, fermented milk products and beverages such as wine and cider. Historically, Lactobacillus species is most often known to be capable of eliciting beneficial effects on the microbiota of the gastrointestinal tract. It helps the body break down food, absorb…arrow_forwardIn details, describe how members of the genus Clostridium cause disease. Thank you!arrow_forward
- Note that it is not appropriate to self-diagnose outside of a medical context and this is a completely hypothetical scenario. Imagine you have a rash on your foot. You're concerned that it's an infection and inoculate a sample onto an agar plate. You wonder, How can I figure out whether the pathogen is a bacterium vs a eukaryote? You decide to use lab supplies to get a basic understanding of the pathogen. Be specific about what tests you use and what you expect the results to be. Limit yourself to experiments we could do in our lab. What is one experiment you could do, involving culturing the organism?arrow_forwardNote that it is not appropriate to self-diagnose outside of a medical context and this is a completely hypothetical scenario. Imagine you have a rash on your foot. You're concerned that it's an infection and inoculate a sample onto an agar plate. You wonder, How can I figure out whether the pathogen is a bacterium vs a eukaryote? You decide to use lab supplies to get a basic understanding of the pathogen. Be specific about what tests you use and what you expect the results to be. Limit yourself to experiments we could do in our lab. What is a procedure you could do, involving making a slide of the organism?arrow_forwardComplete the table below and provide a detailed description of the morphological characteristics and unique features of every microorganism. Classification of Microorganism Name of Microorganism Morphological Characteristics Unique features (habitat, metabolites, structures, etc.) Bacteria 1 Escherichia coli Bacteria 2 Klebsiella pneumoniae Fungi 1 Emericella stellamaris Fungi 2 Aspergillus oryzae Protozoa 1 Green algae (zoochlorellae) Protozoa 2 amoeba (Korotnevella spec.) Virus Bacteriophagesarrow_forward
- go to the website https://www.nature.com/immersive/d42859-019-00041-z/index.html and scroll up and down to review the milestones associated with microbiota research. Answer the questions/ prompts below. Bacteria and our brain? Read the information associated with this milestone and what was discovered. Briefly describe what they found...Milestone/year? What milestone is associated with the debate about when the microbiome is first established? Why is there a debate? Watch the video just below the milestone. What specific type of gene analysis was used to determine that we have our own unique microbiome? Which milestone/year? Sometimes we need antibiotics...this milestone discusses how long it can affect us after infection. In this milestone they discussed how long we could be affected by one course of antibiotics...how long? Which milestone/year? Find the milestone associated with a highly motile bacteria. What disease was treated? How was this treatment used for a…arrow_forwardBelow are a list of virulence factors/ strategies paired with an example of an organism that utilizes them. How do each of the following strategies contribute to the virulence of the pathogen? Strategy - Causes the host to produce more receptors (Organism - Rhinovirus) Strategy - Produces gas as a product of fermentation (Organism - Clostridium perfringens) Strategy - Produces a capsule (organism - Klebsiella pneumonia) Strategy - Ability to move between adjacent cells (organism - Cytomegalovirus) Strategy - Ability to use pilus as a motility structure (organism - Pseudomonas aerogenosa)arrow_forwardFill out the data table attached below with regard to the medically significant bacteria and the diseases it cause. Attached beside is a sample data table for Staphylococcus aureus. Microorganism/Causative Agent: Candida albicansarrow_forward
- Two microbiologists are writing a textbook, but they cannot agree where to place the discussion of botulism. One favored the chapter on nervous system infections, whereas the other insisted on the chapter covering digestive system infections. Where do you think the discussion should be placed, and why?arrow_forwardHello, Can you please help me to answer the nezt question about Salmonella? How would an understanding of this microorganism be helpful in your career as a healthcare provider? Thank you in advance!arrow_forwardYou grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGTarrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education