
Concept explainers
Introduction:
Behavior can be defined as any visual activity of an organism. The behavior of the organisms depends on the genetic component as well as the environmental factors. The behavior is sometimes influenced by the interactions of the communicator with other organisms. The communication is the central process of learning.

Answer to Problem 1MC
Correct answer:
Defending of a certain specific area by a male lizard can be seen as territoriality. Therefore, option (c) is correct.
Option (c) is given as “territoriality”.
Explanation of Solution
Justify reasons for the correct statement:
The territoriality can be defined as the defense of an area which consists of all the important
Hence, option (c) is correct.
Justify reasons for the incorrect statements:
Option (a) is given as “insight learning”.
There are certain times when the organisms are able to solve a certain problem without getting help from their prior experiences. Such kind of problem-solving behavior is termed as insight learning. This behavior is nowhere concerned with defending a certain area. Hence, it is a wrong answer.
Option (b) is given as “kin selection”.
The kin selection ensures that there is some possibility to contribute genetically to the future progeny by assisting close relatives. Through kin selection, the genetically related individuals are cooperated, which promote their survival. A male lizard defends an area is does not exhibit kin selection. Hence, it is a wrong answer.
Option (d) is given as “altruism”.
The altruism refers to the behavior in which the reproductive success of one individual is kept on stake to benefit other individuals. Defending a certain area is not an altruistic behavior. Hence, it is a wrong answer.
Hence, options (a), (b), and (d) are incorrect.
Territoriality is developed when an organism of a species aggressively interact with other organisms of same species to defend a particular area where all the important resources are available.
Want to see more full solutions like this?
Chapter 26 Solutions
Pearson eText Biology: Life on Earth with Physiology -- Instant Access (Pearson+)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning




