
Introduction:
Gonorrhea is a common communicable disease caused by the Neisseria gonorrhoeae. N gonorrhoeae is a gram-negative diplococcus.
Case summary:
Healthy 19 year old woman suffered from nausea, vomiting, headache and neck stiffness. Cerebrospinal fluid and cervical culture showed gram-negative diplococci in leukocytes, however blood culture shows negative.
Symptoms and diagnosis of this case:
Symptoms: Nausea, vomiting, headache and neck stiffness.
Diagnosis: Cerebrospinal fluid and cervical culture showed gram-negative diplococcic in leukocytes, however, blood culture shows negative.
About the disease:
Gonorrhea is a sexually transmitted infection caused by Neisseria gonorrhoeae. It spreads infection through oral and sexual contacts. It affectseyes, rectum, urethra and cervix. The infection is more common in women compared to men. Gonorrhea is treated with cephalosporins.

Want to see the full answer?
Check out a sample textbook solution
Chapter 26 Solutions
Microbiology: An Introduction
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningLifetime Physical Fitness & WellnessHealth & NutritionISBN:9781337677509Author:HOEGERPublisher:Cengage
