
Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 24.11, Problem 1MQ
Summary Introduction
Microbial community dysbiosis (disturbance) is associated with the cause of many diseases. If there is a disturbance in the microbial diversity of intestine, it leads to inflammatory bowel disease (IBD) and obesity.
These diseases can be treated by the intake of microbial cultures which have the ability to improve the gut microbial community and therefore help to treat the disease. These beneficial microbial cultures are termed as probiotics and some plant nutrients termed as prebiotics are also used to enhance the gut microbial health.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 24 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 24.1 - Which major body sites are heavily colonized by...Ch. 24.1 - What methods have been used to assess the human...Ch. 24.1 - Prob. 3MQCh. 24.1 - Prob. 1CRCh. 24.2 - How does the general metabolism of microorganisms...Ch. 24.2 - What is an enterotype?Ch. 24.2 - QHow do microbial diversity and abundance vary...Ch. 24.3 - Prob. 1MQCh. 24.3 - Identify the major microbes that predominate in...Ch. 24.3 - Prob. 3MQ
Ch. 24.3 - Prob. 1CRCh. 24.4 - Prob. 1MQCh. 24.4 - Prob. 2MQCh. 24.4 - Prob. 1CRCh. 24.5 - Prob. 1MQCh. 24.5 - Prob. 2MQCh. 24.5 - Prob. 1CRCh. 24.6 - Prob. 1MQCh. 24.6 - Prob. 2MQCh. 24.6 - Prob. 3MQCh. 24.6 - What are the major anatomical differences between...Ch. 24.7 - Prob. 1MQCh. 24.7 - Prob. 2MQCh. 24.7 - What factor(s) are most important in the...Ch. 24.7 - Prob. 1CRCh. 24.8 - Prob. 1MQCh. 24.8 - Prob. 2MQCh. 24.8 - Prob. 3MQCh. 24.8 - Prob. 1CRCh. 24.9 - What observations indicate that dental carries are...Ch. 24.9 - Prob. 2MQCh. 24.9 - What are some clinical advantages of a...Ch. 24.9 - Why might a therapy based on colonization of the...Ch. 24.10 - Prob. 1MQCh. 24.10 - Prob. 2MQCh. 24.10 - Prob. 1CRCh. 24.11 - Prob. 1MQCh. 24.11 - Prob. 2MQCh. 24.11 - What is the mechanism by which C. scindens...Ch. 24 - Prob. 1AQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Prokaryotic vs. Eukaryotic Cells (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=Pxujitlv8wc;License: Standard youtube license