
To explain:
The steps which should be taken to restore normal microbiota of intestine after extended antibiotic therapy. Also, explain two ways by which exact microbiota and some representative species could also be returned.
Introduction:
Normal microbiota of intestine plays various important roles such as they prevent colonization of pathogens inside the body of an organism. They are also very important for proper digestion of complex carbohydrates for their easy breakdown. These bacteria play an important role in the immune system of the body. Prolonged treatment of antibiotics leads to the destruction and removal of normal microbiota.

Explanation of Solution
Normal microbiota of intestine performs a variety of useful function such as they help in digestion of food particles into simple compounds. They also prevent individual’s body from harmful pathogens and maintain immune responses of the body. If a person is exposed to long term treatment of antibiotics, normal microbiota of body effects in several ways. For restoring normal microbiota probiotics can be taken. These probiotics would help in restoring gut flora following antibiotics. One week probiotics treatment should be given to the patient if he or she is on prolonged antibiotic treatment. Several doses which are sufficient for rebuilding the glycocalyx (a component of the cell wall) can be given for further restoration.
Two ways by which intestinal microbiota and some representative species could be returned are described as below:
(1) For normal microbiota, consumption of probiotics is generally advised in most cases. These probiotics would not show any side effects and can be effectively taken for restoring microbial flora.
(2) Consumption of fiber-rich food is also advised for the restoration of some representative species.
Want to see more full solutions like this?
Chapter 24 Solutions
Brock Biology of Microorganisms (15th Edition)
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Microbiology for Surgical Technologists (MindTap ...BiologyISBN:9781111306663Author:Margaret Rodriguez, Paul PricePublisher:Cengage LearningComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage

