
The lowest blood concentration of nitrogenous waste occurs in the (a) hepatic vein, (b) inferior vena cava, (c) renal artery, (d) renal vein.

Introduction:
The urinary system or renal system is made up of kidneys, ureters, bladder and the urethra. All these organs are essential for the elimination of nitrogenous waste from the body. This system also regulate blood volume and blood pressure by controlling the levels of electrolytes and metabolites. Kidney consists of extensive blood supply through the renal arteries that leave the kidney via the renal vein. The concentration of the nitrogenous waste shows variation in different part of blood supply.
Answer to Problem 1MC
Correct answer:
Renal vein consists of the lowest blood concentration of nitrogenous waste.
Explanation of Solution
Explanation for the correct answer:
The veins that drain the kidney is known as renal veins. These veins connect the kidney to the inferior vena cava. The blood carried by these veins undergo filteration process in the kidney and consists the lowest amont of nitrogenous waste. Hence option (d) is the correct option.
Explanation for the incorrect answers:
Option (a) states that hepatic vein contains the lowest amount of nitrogenous waste. The hepatic vein transports the deoxygenated blood from the liver to the heart through the inferior vena cava. Hence this is an incorrect option.
Option (b) states that inferior vena cava contains the lowest amount of nitrogenous waste. Inferior vena cava is a large vein that carries deoxygenated blood from body into the right atrium of the heart. Hence this is an incorrect option.
Option (c) states that renal artery contains the lowest amount of nitrogenous waste. The renal artery supplies oxygenated blood to the kidneys, which is not filtered. Hence option (c) is an incorrect option.
Thus it is concluded that renal veins consists the lowest blood concentration of nitrogenous waste.
Want to see more full solutions like this?
Chapter 24 Solutions
Anatomy & Physiology (6th Edition)
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningEssentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage
