
Foundations in Microbiology
9th Edition
ISBN: 9780073522609
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 23.3, Problem 10ELO
Summary Introduction
To identify:
Comparision of vectors involved in sleeping sickness, Chagas disease, and leishmaniasis.
Introduction:
Trypanosomiasis are distinguishted into two types; Trypanosoma brucei is the agent of African sleeping sickness, and T. cruzi is the cause of Chagas disease, which is endemic to the Americas.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 23 Solutions
Foundations in Microbiology
Ch. 23.1 - Prob. 1ELOCh. 23.1 - How do travel, immigration, and AIDS all affect...Ch. 23.2 - Prob. 2ELOCh. 23.2 - Identify the amoebas generally seen as human...Ch. 23.2 - Prob. 4ELOCh. 23.2 - Prob. 5ELOCh. 23.2 - Classify and describe the important...Ch. 23.2 - Prob. 2CYPCh. 23.2 - Prob. 3CYPCh. 23.2 - Prob. 4CYP
Ch. 23.2 - Outline the course of typical Entamoeba, Naegleri,...Ch. 23.2 - Relate the life cycle, pathogenesis, and control...Ch. 23.3 - Describe the important characteristics of...Ch. 23.3 - Prob. 8ELOCh. 23.3 - Prob. 9ELOCh. 23.3 - Prob. 10ELOCh. 23.3 - Compare the pathologies of sleeping sickness,...Ch. 23.3 - Describe Trichomonas vaginalis with respect to...Ch. 23.3 - Compare the relative importance of protozoan cysts...Ch. 23.3 - Compare the infective stages and means of vector...Ch. 23.3 - Prob. 10CYPCh. 23.3 - Prob. 11CYPCh. 23.3 - Prob. 12CYPCh. 23.3 - Prob. 13CYPCh. 23.4 - Prob. 12ELOCh. 23.4 - Explain the endemic occurrence of malaria.Ch. 23.4 - Prob. 14ELOCh. 23.4 - Prob. 15ELOCh. 23.4 - Prob. 16ELOCh. 23.4 - Describe the life cycle of Toxoplasma gondii.Ch. 23.4 - Prob. 18ELOCh. 23.4 - Prob. 19ELOCh. 23.4 - Prob. 14CYPCh. 23.4 - Explain why malaria is a greater concern in some...Ch. 23.4 - Prob. 16CYPCh. 23.4 - Prob. 17CYPCh. 23.4 - Prob. 18CYPCh. 23.4 - Prob. 19CYPCh. 23.4 - Prob. 20CYPCh. 23.4 - Why don’t common methods of water treatment...Ch. 23.4 - Prob. 22CYPCh. 23.5 - Prob. 20ELOCh. 23.5 - Prob. 21ELOCh. 23.5 - Prob. 22ELOCh. 23.5 - Describe the strategies used to diagnose and...Ch. 23.5 - Prob. 23CYPCh. 23.5 - Prob. 24CYPCh. 23.5 - Contrast the important points of the four basic...Ch. 23.5 - Prob. 26CYPCh. 23.5 - Prob. 27CYPCh. 23.6 - Identify the transmission cycle of each of the...Ch. 23.6 - Summarize the mode of infestation and pathology of...Ch. 23.6 - Prob. 26ELOCh. 23.6 - Prob. 27ELOCh. 23.6 - Prob. 28ELOCh. 23.6 - Prob. 29ELOCh. 23.6 - Prob. 28CYPCh. 23.6 - Prob. 29CYPCh. 23.6 - Prob. 30CYPCh. 23.6 - Prob. 31CYPCh. 23.6 - Prob. 32CYPCh. 23.6 - Prob. 33CYPCh. 23.6 - Prob. 34CYPCh. 23.6 - Construet a table providing the name of the...Ch. 23.6 - Prob. 36CYPCh. 23.7 - Prob. 30ELOCh. 23.7 - Recall the stages of the Schistosoma life cycle.Ch. 23.7 - Prob. 32ELOCh. 23.7 - Prob. 33ELOCh. 23.7 - Provide examples of intermediate and definitive...Ch. 23.7 - Prob. 38CYPCh. 23.7 - Prob. 39CYPCh. 23.7 - Prob. 40CYPCh. 23.8 - Differentiate among the arthropod vectors of...Ch. 23.8 - Describe the relationship between arthropod...Ch. 23.8 - Prob. 41CYPCh. 23.8 - Prob. 42CYPCh. 23.8 - Prob. 43CYPCh. 23.L1 - All protozoan pathogens have a ______ phase. a....Ch. 23.L1 - Entamoeba histolytica primarily invades the a....Ch. 23.L1 - Prob. 3MCQCh. 23.L1 - Prob. 4MCQCh. 23.L1 - Plasmodium reproduces sexually in the _____ and...Ch. 23.L1 - Prob. 6MCQCh. 23.L1 - Prob. 7MCQCh. 23.L1 - Prob. 8MCQCh. 23.L1 - All adult helminths produce a. cysts and...Ch. 23.L1 - The _____ host is where the larva develops, and...Ch. 23.L1 - Antihelminthic medications work by a. paralyzing...Ch. 23.L1 - Host defenses that are most active in worm...Ch. 23.L1 - Prob. 13MCQCh. 23.L1 - Prob. 14MCQCh. 23.L1 - Prob. 15MCQCh. 23.L1 - The swelling of limbs typical of elephantiasis is...Ch. 23.L1 - Prob. 17MCQCh. 23.L1 - Prob. 18MCQCh. 23.L1 - Single Matching. Match the disease or condition...Ch. 23.L1 - Single Matching. Match the disease with its...Ch. 23.L1 - Prob. 1CSRCh. 23.L1 - Infection with which organism could produce...Ch. 23.L1 - Provide at least two reasons that primary amebic...Ch. 23.L1 - As a review, compare the four major groups of...Ch. 23.L1 - a.What are the primary functions of the...Ch. 23.L1 - Prob. 3WCCh. 23.L1 - Prob. 4WCCh. 23.L1 - In what ways is trichinellosis different from...Ch. 23.L1 - Prob. 6WCCh. 23.L2 - Explain why a person with overt symptoms of...Ch. 23.L2 - a. Explain why Trichomonas vaginalis is less...Ch. 23.L2 - Prob. 3CTCh. 23.L2 - Prob. 4CTCh. 23.L2 - Prob. 5CTCh. 23.L2 - Prob. 6CTCh. 23.L2 - Prob. 7CTCh. 23.L2 - Prob. 8CTCh. 23.L2 - Prob. 9CTCh. 23.L2 - Prob. 10CTCh. 23.L2 - Students sometimes react with horror and distress...Ch. 23.L2 - a. Why is it necessary for most parasites to leave...Ch. 23.L2 - Prob. 13CTCh. 23.L2 - In New York City, four Orthodox Jewish patients...Ch. 23.L2 - Prob. 1VCCh. 23.L2 - Prob. 2VC
Knowledge Booster
Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningHealth Safety And Nutrition F/Young ChildHealth & NutritionISBN:9781305144767Author:MAROTZPublisher:Cengage
- Case Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Health Safety And Nutrition F/Young Child
Health & Nutrition
ISBN:9781305144767
Author:MAROTZ
Publisher:Cengage
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage