Biology: The Dynamic Science (MindTap Course List)
4th Edition
ISBN: 9781305389892
Author: Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 23.1, Problem 3SB
Summary Introduction
To review:
The type of information paleobiologists extract from a fossil record.
Introduction:
Though fossil records are often inadequate and inaccurate, they are a direct source of information about life in the past. Studying the changing pattern of fossils provide the evidence that the physical environment of the earth has undergone a great extent of evolution.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What are type specimens? Why are they important?
What is the difference between Fossils and Trace Fossils.
What is meant by the term “intermediate fossil” when referring to the fossil record?
Chapter 23 Solutions
Biology: The Dynamic Science (MindTap Course List)
Ch. 23.1 - What biological materials are the most likely to...Ch. 23.1 - Prob. 2SBCh. 23.1 - Prob. 3SBCh. 23.2 - Prob. 1SBCh. 23.2 - Prob. 2SBCh. 23.3 - Which type of geographical distribution requires...Ch. 23.3 - Why do distantly related species that live in...Ch. 23.4 - What factors might allow a population of organisms...Ch. 23.4 - What events apparently triggered the mass...Ch. 23.4 - Prob. 3SB
Ch. 23.5 - Prob. 1SBCh. 23.5 - Prob. 2SBCh. 23.6 - Prob. 1SBCh. 23.6 - Prob. 2SBCh. 23.6 - Prob. 3SBCh. 23 - The fossil record: a. provides direct and indirect...Ch. 23 - The absolute age of a geological stratum is...Ch. 23 - Prob. 3TYKCh. 23 - Prob. 4TYKCh. 23 - Biologists believe that the overall similarities...Ch. 23 - The differential growth of body parts is called:...Ch. 23 - Exaptations are traits that: a. prepare some...Ch. 23 - Adaptive radiations often follow mass extinctions...Ch. 23 - Prob. 9TYKCh. 23 - Prob. 10TYKCh. 23 - Prob. 11TYKCh. 23 - Prob. 12TYKCh. 23 - Prob. 13TYKCh. 23 - Prob. 14TYKCh. 23 - Prob. 15TYKCh. 23 - Prob. 1ITD
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What are the characteristics/features of Upper Paleolithic industry tools. What do these tools tell us about the culture of early modern Homo sapiens?arrow_forwardWhich is more common: anagenesis or cladogenesis ?arrow_forwardWhat are the challenges of estimating the ages of old fossils?Explain how these challenges may be overcome in somecircumstances.arrow_forward
- How did the prints become trace fossils?arrow_forwardIn the shale unit, you find the following fossil: What is the mode of preservation of this fossil? Recrystallization Internal mold Replacement External mold Carbonizationarrow_forwardHow is the layer of iridium used to tell the relative age of different rock strata and fossils?arrow_forward
- How do we know how old a fossil is? A) We compare it to current species and see how much has changed B) We see how much soil is on top of it C) We use radiometric datingarrow_forwardFrom the DNA sequence data for the eight species (A through H) shown below, what is the genetic distance between Species A and Species C? O 4 5 6 1 O 7 2 3 4 Species A ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATAAAG ACT Species B ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATAAAGACT Species C ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species D ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT E Species Species F ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT G ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT Species H ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT 5 6 7arrow_forwardWhy did Shubin and his colleagues choose to look in the Canadian Arctic for transitional fossils?arrow_forward
- An organism dies,and its body leaves an impression in mud. Over time, the mud hardens into rock, and the impression becomes a fossil. Which kind of fossil was formed? A) cast B) mold C) original material D) trace fossilarrow_forwardExplain why it is difficult to use carbon-14 dating on 100-million-year-old dinosaur fossilsarrow_forwardBased on the information from the following table and the provided phylogenetic tree, what kind of species classification is shown? A B C D E F G H 1 J K L M N O Form of Male Genitalia 1 1 L L L L L L L L L L L L L r T Pits) or Tubercles E P P T T T T T P P P P P Р P P O Phenetic Species Concept O Blological Species Concept O Phylogenetic Species Concept O Sympatric Species Concept Blayple (OUTGROUP) beaver Dan, AZ -Twentynine Paime, CA -Harkavilla, UT D-Chilchinbio, NM -Vermilion Cas. AZ 64 -F-Mone Lake, CA -G-Coral Pink Danes, UT H-Pyramid Lake, N -Crescent Dunes, MV Meno Lake CA -K-Olancha CA -Olancha, CA --Winnemucca, NV -El Mirage, CA Lo-Dumont Dunes, CA Form of dorsal ridges M₁ M₁ FFFFFFFFFF M Ma M₂ M₂arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Fossil: The Language & History of Paleontology; Author: Alliterative;https://www.youtube.com/watch?v=x9yNwRBlKtU;License: Standard youtube license