ANATOMY+PHYSIOLOGY >CUSTOM<
9th Edition
ISBN: 2818440061721
Author: SALADIN
Publisher: MCG/CREATE
expand_more
expand_more
format_list_bulleted
Question
Chapter 22.3, Problem 17BYGO
Summary Introduction
Introduction:
Gas exchange is a process where oxygen (O2) is transported from the lungs to the blood and carbon dioxide (CO2) is removed from the blood to the lungs. Blood has red blood cells (RBCs) which contain a red pigment called as hemoglobin (Hb). It is a metalloprotein that is present in the RBCs of mammals. The structural components of Hb are that it is a multi-subunit protein, which has a heme part made of porphyrin ring that is linked with iron and a globin part. The key role of Hb is to transport oxygen and deliver it to the tissues.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 22 Solutions
ANATOMY+PHYSIOLOGY >CUSTOM<
Ch. 22.1 - A dust particle is inhaled and gets into an...Ch. 22.1 - Prob. 2BYGOCh. 22.1 - Prob. 3BYGOCh. 22.1 - Prob. 4BYGOCh. 22.1 - Prob. 5BYGOCh. 22.1 - Prob. 6BYGOCh. 22.1 - Prob. 1AYLOCh. 22.1 - Prob. 2AYLOCh. 22.1 - Prob. 3AYLOCh. 22.1 - Prob. 4AYLO
Ch. 22.1 - Prob. 5AYLOCh. 22.1 - Prob. 6AYLOCh. 22.1 - Prob. 7AYLOCh. 22.1 - Gross anatomy of the lungs; how the right and left...Ch. 22.1 - Prob. 9AYLOCh. 22.1 - How bronchioles differ from bronchi; two types of...Ch. 22.1 - Prob. 11AYLOCh. 22.1 - Prob. 12AYLOCh. 22.2 - Prob. 7BYGOCh. 22.2 - Prob. 8BYGOCh. 22.2 - Prob. 9BYGOCh. 22.2 - Prob. 10BYGOCh. 22.2 - Prob. 11BYGOCh. 22.2 - Suppose a healthy person has a tidal volume of 650...Ch. 22.2 - Prob. 13BYGOCh. 22.2 - Prob. 1AYLOCh. 22.2 - Prob. 2AYLOCh. 22.2 - Prob. 3AYLOCh. 22.2 - Locations and roles of the central and peripheral...Ch. 22.2 - Prob. 5AYLOCh. 22.2 - Prob. 6AYLOCh. 22.2 - Prob. 7AYLOCh. 22.2 - Prob. 8AYLOCh. 22.2 - Prob. 9AYLOCh. 22.2 - Prob. 10AYLOCh. 22.2 - Prob. 11AYLOCh. 22.2 - Prob. 12AYLOCh. 22.2 - Use of the spirometer to measure pulmonary...Ch. 22.2 - Prob. 14AYLOCh. 22.2 - Prob. 15AYLOCh. 22.2 - Prob. 16AYLOCh. 22.3 - Why is the composition of alveolar air different...Ch. 22.3 - Prob. 15BYGOCh. 22.3 - Prob. 16BYGOCh. 22.3 - Prob. 17BYGOCh. 22.3 - Prob. 18BYGOCh. 22.3 - Prob. 19BYGOCh. 22.3 - Prob. 20BYGOCh. 22.3 - Prob. 21BYGOCh. 22.3 - Prob. 22BYGOCh. 22.3 - Composition of the atmosphere and average partial...Ch. 22.3 - Prob. 2AYLOCh. 22.3 - Prob. 3AYLOCh. 22.3 - Prob. 4AYLOCh. 22.3 - Prob. 5AYLOCh. 22.3 - Prob. 6AYLOCh. 22.3 - Prob. 7AYLOCh. 22.3 - Prob. 8AYLOCh. 22.3 - Prob. 9AYLOCh. 22.3 - Prob. 10AYLOCh. 22.3 - Prob. 11AYLOCh. 22.3 - Prob. 12AYLOCh. 22.3 - Prob. 13AYLOCh. 22.3 - Prob. 14AYLOCh. 22.3 - Prob. 15AYLOCh. 22.3 - Prob. 16AYLOCh. 22.4 - Prob. 23BYGOCh. 22.4 - Prob. 24BYGOCh. 22.4 - Prob. 25BYGOCh. 22.4 - The definition of hypoxia; its four varieties and...Ch. 22.4 - Prob. 2AYLOCh. 22.4 - Prob. 3AYLOCh. 22.4 - The most common cause of lung cancer, and the...Ch. 22 - The nasal cavity is divided by the nasal septum...Ch. 22 - The intrinsic laryngeal muscles regulate speech by...Ch. 22 - The latest air passages that engage in gas...Ch. 22 - Prob. 4TYRCh. 22 - Prob. 5TYRCh. 22 - Prob. 6TYRCh. 22 - According to_______ the warming of air as it is...Ch. 22 - Prob. 8TYRCh. 22 - Prob. 9TYRCh. 22 - Prob. 10TYRCh. 22 - Prob. 11TYRCh. 22 - Within each lung, the airway forms a branching...Ch. 22 - Prob. 13TYRCh. 22 - Prob. 14TYRCh. 22 - Prob. 15TYRCh. 22 - Some inhaled air does not participate in gas...Ch. 22 - Prob. 17TYRCh. 22 - Prob. 18TYRCh. 22 - The matching of airflow to blood flow in any...Ch. 22 - Prob. 20TYRCh. 22 - Prob. 1BYMVCh. 22 - Prob. 2BYMVCh. 22 - Prob. 3BYMVCh. 22 - Prob. 4BYMVCh. 22 - eu-Ch. 22 - meterCh. 22 - Prob. 7BYMVCh. 22 - Prob. 8BYMVCh. 22 - Prob. 9BYMVCh. 22 - Prob. 10BYMVCh. 22 - Prob. 1WWTSCh. 22 - Prob. 2WWTSCh. 22 - Prob. 3WWTSCh. 22 - Prob. 4WWTSCh. 22 - Prob. 5WWTSCh. 22 - Prob. 6WWTSCh. 22 - Prob. 7WWTSCh. 22 - Prob. 8WWTSCh. 22 - Prob. 9WWTSCh. 22 - Prob. 10WWTSCh. 22 - Prob. 1TYCCh. 22 - State whether hyperventilation would raise or...Ch. 22 - Prob. 3TYCCh. 22 - Consider a man in good health with a 650 mL tidal...Ch. 22 - Prob. 5TYC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Respiratory System; Author: Amoeba Sisters;https://www.youtube.com/watch?v=v_j-LD2YEqg;License: Standard youtube license