HUMAN ANATOMY
6th Edition
ISBN: 9781260986037
Author: SALADIN
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 22.2, Problem 2AWYK
Summary Introduction
To determine:
The reason that lymph nodes are the only lymphatic organs that can filter the lymph.
Introduction:
The organs at which the production and maturation of lymphocytes occur are called primary lymphoid organs. Humans have two primary lymphoid organs. These are thymus and the red bone marrow.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 22 Solutions
HUMAN ANATOMY
Ch. 22.1 - Prob. 1AWYKCh. 22.1 - Prob. 1BYGOCh. 22.1 - Prob. 2BYGOCh. 22.1 - Prob. 3BYGOCh. 22.2 - If we regard red bone marrow as a lymphatic organ...Ch. 22.2 - Prob. 2AWYKCh. 22.2 - Prob. 3AWYKCh. 22.2 - Prob. 4BYGOCh. 22.2 - Prob. 5BYGOCh. 22.2 - Prob. 6BYGO
Ch. 22.2 - Prob. 7BYGOCh. 22.2 - Prob. 8BYGOCh. 22.2 - Prob. 9BYGOCh. 22.2 - Prob. 10BYGOCh. 22.2 - Prob. 11BYGOCh. 22.3 - Prob. 1AWYKCh. 22.3 - Prob. 12BYGOCh. 22.3 - Answer the following questions to test your...Ch. 22.3 - Prob. 14BYGOCh. 22.3 - Prob. 15BYGOCh. 22.3 - Prob. 16BYGOCh. 22.4 - Prob. 17BYGOCh. 22.4 - Prob. 18BYGOCh. 22.4 - Prob. 19BYGOCh. 22 - Prob. 22.1.1AYLOCh. 22 - Prob. 22.1.2AYLOCh. 22 - Prob. 22.1.3AYLOCh. 22 - Prob. 22.1.4AYLOCh. 22 - Prob. 22.1.5AYLOCh. 22 - To test your knowledge, discuss the following...Ch. 22 - Prob. 22.1.7AYLOCh. 22 - Prob. 22.2.1AYLOCh. 22 - Prob. 22.2.2AYLOCh. 22 - Prob. 22.2.3AYLOCh. 22 - Prob. 22.2.4AYLOCh. 22 - Prob. 22.2.5AYLOCh. 22 - Prob. 22.2.6AYLOCh. 22 - Prob. 22.2.7AYLOCh. 22 - Prob. 22.2.8AYLOCh. 22 - Prob. 22.2.9AYLOCh. 22 - To test your knowledge, discuss the following...Ch. 22 - Prob. 22.2.11AYLOCh. 22 - Prob. 22.2.12AYLOCh. 22 - Prob. 22.2.13AYLOCh. 22 - Prob. 22.2.14AYLOCh. 22 - To test your knowledge, discuss the following...Ch. 22 - To test your knowledge, discuss the following...Ch. 22 - Prob. 22.3.1AYLOCh. 22 - Prob. 22.3.2AYLOCh. 22 - Prob. 22.3.3AYLOCh. 22 - Prob. 22.3.4AYLOCh. 22 - Prob. 22.3.5AYLOCh. 22 - Prob. 22.3.6AYLOCh. 22 - Prob. 22.3.7AYLOCh. 22 - Prob. 22.3.8AYLOCh. 22 - Prob. 22.3.9AYLOCh. 22 - Prob. 22.3.10AYLOCh. 22 - Prob. 22.4.1AYLOCh. 22 - Prob. 22.4.2AYLOCh. 22 - Prob. 22.4.3AYLOCh. 22 - Prob. 22.4.4AYLOCh. 22 - Prob. 1TYRCh. 22 - Prob. 2TYRCh. 22 - The lethal hit is used by __________ to kill enemy...Ch. 22 - Prob. 4TYRCh. 22 - Which of these lymphatic organs has a cortex and...Ch. 22 - Prob. 6TYRCh. 22 - Prob. 7TYRCh. 22 - Prob. 8TYRCh. 22 - Prob. 9TYRCh. 22 - Prob. 10TYRCh. 22 - Prob. 11TYRCh. 22 - Prob. 12TYRCh. 22 - Lymphatic vessels called _____________ carry lymph...Ch. 22 - Prob. 14TYRCh. 22 - Prob. 15TYRCh. 22 - Prob. 16TYRCh. 22 - Prob. 17TYRCh. 22 - Prob. 18TYRCh. 22 - Prob. 19TYRCh. 22 - Prob. 20TYRCh. 22 - Prob. 1BYMVCh. 22 - Prob. 2BYMVCh. 22 - Prob. 3BYMVCh. 22 - Prob. 4BYMVCh. 22 - Prob. 5BYMVCh. 22 - Prob. 6BYMVCh. 22 - Prob. 7BYMVCh. 22 - Prob. 8BYMVCh. 22 - Prob. 9BYMVCh. 22 - Prob. 10BYMVCh. 22 - Prob. 1WWWTSCh. 22 - Prob. 2WWWTSCh. 22 - Prob. 3WWWTSCh. 22 - Prob. 4WWWTSCh. 22 - Prob. 5WWWTSCh. 22 - Prob. 6WWWTSCh. 22 - Prob. 7WWWTSCh. 22 - Prob. 8WWWTSCh. 22 - Prob. 9WWWTSCh. 22 - Prob. 10WWWTSCh. 22 - Prob. 1TYCCh. 22 - Prob. 2TYCCh. 22 - Prob. 3TYCCh. 22 - Prob. 4TYCCh. 22 - Prob. 5TYC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningUnderstanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:Cengage

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College


Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage
12 Organ Systems | Roles & functions | Easy science lesson; Author: Learn Easy Science;https://www.youtube.com/watch?v=cQIU0yJ8RBg;License: Standard youtube license