Concept explainers
To determine:
The different components that constitute a lymphatic system.
Introduction:
The major function of the lymphatic system is to maintain the balance between body fluids. It also provides immunity by generating different types of immune cells. It is not possible for the circulatory system and immune system to work without the lymphatic system.

Explanation of Solution
The lymphatic system comprises of the following components:
- Lymph:
- Lymphatic vessels:
- Lymphatic tissues:
- Lymphatic organs:
A fluid similar to blood plasma that is usually clear and colorless and is low in protein content. This fluid is taken up by the lymphatic vessels. The composition of lymph varies from time to time and from place to place. For example: after a meal, the lymph turns to milky in appearance due to the presence of high lipid content. The different substances that are present in the lymph are macrophages, hormones, bacteria, viruses and traveling cancer cells.
These are similar to that of blood vessels. These vessels reach every part of the body except cartilage, bone, bone marrow and cornea. These vessels close at one end
The aggregation of the cells, lymphocytes forms the lymphatic tissue. The simplest type of lymphatic tissue is that in which lymphocytes are not densely clustered rather, they are scattered. These simple types of lymphatic tissues are referred to as diffuse lymphatic tissue.
These are also known as lymphoid organs. Redbone marrow, thymus, lymph nodes, tonsils and spleen all come under lymphatic organs. Out of these, red bone marrow and thymus come under primary lymphatic tissue, and rest all are categorized under the secondary lymphatic organs.
The lymphatic organs are vital for our body as it helps in producing different types of response against any bacteria or virus that invades in the human body.
Want to see more full solutions like this?
Chapter 22 Solutions
HUMAN ANATOMY
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
