
EBK FOUNDATIONS IN MICROBIOLOGY: BASIC
10th Edition
ISBN: 9781259916045
Author: TALARO
Publisher: MCGRAW HILL BOOK COMPANY
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 2.2, Problem 9ELO
Summary Introduction
To determine:
And summarize the concepts of valence, polarity and diatomic elements.
Introduction:
Atoms are rarely found in nature in a pure and uncombined state. They usually combine with other atoms to form molecules and compounds. The bond forming capacity of atoms of different elements is determined by their electrons. The properties of the resulting molecules and compounds are also determined by the degree of sharing or transfer of electrons between the participating atoms.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 2 Solutions
EBK FOUNDATIONS IN MICROBIOLOGY: BASIC
Ch. 2.1 - Prob. 1ELOCh. 2.1 - Prob. 2ELOCh. 2.1 - Prob. 3ELOCh. 2.1 - Prob. 4ELOCh. 2.1 - Prob. 5ELOCh. 2.1 - Prob. 1CYPCh. 2.1 - Prob. 2CYPCh. 2.1 - Prob. 3CYPCh. 2.1 - Prob. 4CYPCh. 2.1 - Prob. 5CYP
Ch. 2.1 - Prob. 6CYPCh. 2.2 - Prob. 6ELOCh. 2.2 - Prob. 7ELOCh. 2.2 - Prob. 8ELOCh. 2.2 - Prob. 9ELOCh. 2.2 - Prob. 10ELOCh. 2.2 - Prob. 11ELOCh. 2.2 - 7. Explain how the concepti of molecules and...Ch. 2.2 - Prob. 8CYPCh. 2.2 - Prob. 9CYPCh. 2.2 - Prob. 10CYPCh. 2.2 - Prob. 11CYPCh. 2.2 - Prob. 12CYPCh. 2.2 - Prob. 13CYPCh. 2.2 - Prob. 14CYPCh. 2.3 - Prob. 12ELOCh. 2.3 - 13. Explain solutes, solvents, and hydration.Ch. 2.3 - Prob. 14ELOCh. 2.3 - 15. Describe the pH scale and how it was derived;...Ch. 2.3 - Prob. 15CYPCh. 2.3 - Prob. 16CYPCh. 2.3 - 17. What properties of water make it an effective...Ch. 2.3 - Prob. 18CYPCh. 2.3 - 19. What determines whether a substance is an acid...Ch. 2.4 - 16. Describe the chemistry of carbon and the...Ch. 2.4 - Prob. 17ELOCh. 2.4 - Prob. 18ELOCh. 2.4 - Prob. 20CYPCh. 2.4 - Prob. 21CYPCh. 2.4 - Prob. 22CYPCh. 2.4 - 23. What are functional groups?Ch. 2.4 - Prob. 24CYPCh. 2.5 - 19. Define carbohydrate and know the functional...Ch. 2.5 - Prob. 20ELOCh. 2.5 - 21. Discuss the functions of carbohydrates in...Ch. 2.5 - Prob. 25CYPCh. 2.5 - Prob. 26CYPCh. 2.5 - 27. What are some of the functions of...Ch. 2.6 - 22. Define lipid, triglyceride, phospholipid,...Ch. 2.6 - 23. Describe how an ester bond is formed.Ch. 2.6 - Prob. 24ELOCh. 2.6 - 28. Draw simple structural molecules of...Ch. 2.7 - 25. Describe the structures of peptides and...Ch. 2.7 - 26. Characterize the four levels of protein...Ch. 2.7 - 27. Summarize some of the essential functions of...Ch. 2.7 - Prob. 29CYPCh. 2.7 - 30. Differentiate between a peptide, a...Ch. 2.7 - 31. Explain what causes the various levels of...Ch. 2.7 - 32. What functions do proteins perform in a cell?Ch. 2.8 - 28. Identify a nucleic acid and differentiate...Ch. 2.8 - Prob. 29ELOCh. 2.8 - 30. Explain how the DNA code may be copied, and...Ch. 2.8 - 33. Describe a nucleotide and a polynucleotide,...Ch. 2.8 - 34. Name the two purines and the three...Ch. 2.8 - 35. What are the functions of RNA?Ch. 2.8 - 36.What is ATP, and how does it function in cells?Ch. 2.L1 - 1. The smallest unit of matter with unique...Ch. 2.L1 - 2. The charge of a proton is exactly balanced by...Ch. 2.L1 - Prob. 3MCQCh. 2.L1 - Prob. 4MCQCh. 2.L1 - Prob. 5MCQCh. 2.L1 - Prob. 6MCQCh. 2.L1 - Prob. 7MCQCh. 2.L1 - 8. An atom that can donate electrons during a...Ch. 2.L1 - 9. In a solution of NaCl and water, NaCl is the...Ch. 2.L1 - 10. A solution with a pH of 2 than a solution with...Ch. 2.L1 - 11. Fructose is a type of a. disaccharide b....Ch. 2.L1 - 6. Bonds in which atoms share electrons are...Ch. 2.L1 - 13. How is our understanding of microbiology...Ch. 2.L1 - 14. A phospholipid contains a. three fatty acids...Ch. 2.L1 - 15. Proteins are synthesized by linking amino...Ch. 2.L1 - 16. The amino acid that accounts for disulfide...Ch. 2.L1 - 17. DNA is a hereditary molecule that is composed...Ch. 2.L1 - 18. What is meant by the term DMA replication? a....Ch. 2.L1 - 19. Proteins can function as a. enzymes b....Ch. 2.L1 - 20. RNA plays an important role in what biological...Ch. 2.L1 - 1. Which of the following has not been a major...Ch. 2.L1 - 2. What was a significant result of the Mars...Ch. 2.L1 - Prob. 3CSRCh. 2.L1 - Prob. 1WCCh. 2.L1 - Prob. 2WCCh. 2.L1 - Prob. 3WCCh. 2.L1 - Prob. 4WCCh. 2.L1 - Prob. 5WCCh. 2.L1 - 6. Why are hydrogen bonds relatively weak?Ch. 2.L1 - 7. What kind of substances will be expected to be...Ch. 2.L1 - Prob. 8WCCh. 2.L1 - Prob. 9WCCh. 2.L1 - 10. What makes the amino acids distinctive, and...Ch. 2.L1 - Prob. 11WCCh. 2.L1 - Prob. 12WCCh. 2.L1 - 6. Bonds in which atoms share electrons are...Ch. 2.L2 - Prob. 1CTCh. 2.L2 - Prob. 2CTCh. 2.L2 - Prob. 3CTCh. 2.L2 - 4. Distinguish between polar and ionic compounds.Ch. 2.L2 - 5. Is galactose an aldehyde or a ketone sugar?Ch. 2.L2 - 6. a. How many water molecules are released when a...Ch. 2.L2 - Prob. 7CTCh. 2.L2 - Prob. 8CTCh. 2.L2 - Prob. 1VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license