
EBK FOUNDATIONS IN MICROBIOLOGY: BASIC
10th Edition
ISBN: 9781259916045
Author: TALARO
Publisher: MCGRAW HILL BOOK COMPANY
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 2.1, Problem 5ELO
Summary Introduction
To determine:
- The definition of electron orbitals and energy shells.
- How they are filled.
Introduction:
The structure of an atom is visualized by imagining a central core made of protons and neutrons around which clouds of electrons continuously spin in defined pathways.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 2 Solutions
EBK FOUNDATIONS IN MICROBIOLOGY: BASIC
Ch. 2.1 - Prob. 1ELOCh. 2.1 - Prob. 2ELOCh. 2.1 - Prob. 3ELOCh. 2.1 - Prob. 4ELOCh. 2.1 - Prob. 5ELOCh. 2.1 - Prob. 1CYPCh. 2.1 - Prob. 2CYPCh. 2.1 - Prob. 3CYPCh. 2.1 - Prob. 4CYPCh. 2.1 - Prob. 5CYP
Ch. 2.1 - Prob. 6CYPCh. 2.2 - Prob. 6ELOCh. 2.2 - Prob. 7ELOCh. 2.2 - Prob. 8ELOCh. 2.2 - Prob. 9ELOCh. 2.2 - Prob. 10ELOCh. 2.2 - Prob. 11ELOCh. 2.2 - 7. Explain how the concepti of molecules and...Ch. 2.2 - Prob. 8CYPCh. 2.2 - Prob. 9CYPCh. 2.2 - Prob. 10CYPCh. 2.2 - Prob. 11CYPCh. 2.2 - Prob. 12CYPCh. 2.2 - Prob. 13CYPCh. 2.2 - Prob. 14CYPCh. 2.3 - Prob. 12ELOCh. 2.3 - 13. Explain solutes, solvents, and hydration.Ch. 2.3 - Prob. 14ELOCh. 2.3 - 15. Describe the pH scale and how it was derived;...Ch. 2.3 - Prob. 15CYPCh. 2.3 - Prob. 16CYPCh. 2.3 - 17. What properties of water make it an effective...Ch. 2.3 - Prob. 18CYPCh. 2.3 - 19. What determines whether a substance is an acid...Ch. 2.4 - 16. Describe the chemistry of carbon and the...Ch. 2.4 - Prob. 17ELOCh. 2.4 - Prob. 18ELOCh. 2.4 - Prob. 20CYPCh. 2.4 - Prob. 21CYPCh. 2.4 - Prob. 22CYPCh. 2.4 - 23. What are functional groups?Ch. 2.4 - Prob. 24CYPCh. 2.5 - 19. Define carbohydrate and know the functional...Ch. 2.5 - Prob. 20ELOCh. 2.5 - 21. Discuss the functions of carbohydrates in...Ch. 2.5 - Prob. 25CYPCh. 2.5 - Prob. 26CYPCh. 2.5 - 27. What are some of the functions of...Ch. 2.6 - 22. Define lipid, triglyceride, phospholipid,...Ch. 2.6 - 23. Describe how an ester bond is formed.Ch. 2.6 - Prob. 24ELOCh. 2.6 - 28. Draw simple structural molecules of...Ch. 2.7 - 25. Describe the structures of peptides and...Ch. 2.7 - 26. Characterize the four levels of protein...Ch. 2.7 - 27. Summarize some of the essential functions of...Ch. 2.7 - Prob. 29CYPCh. 2.7 - 30. Differentiate between a peptide, a...Ch. 2.7 - 31. Explain what causes the various levels of...Ch. 2.7 - 32. What functions do proteins perform in a cell?Ch. 2.8 - 28. Identify a nucleic acid and differentiate...Ch. 2.8 - Prob. 29ELOCh. 2.8 - 30. Explain how the DNA code may be copied, and...Ch. 2.8 - 33. Describe a nucleotide and a polynucleotide,...Ch. 2.8 - 34. Name the two purines and the three...Ch. 2.8 - 35. What are the functions of RNA?Ch. 2.8 - 36.What is ATP, and how does it function in cells?Ch. 2.L1 - 1. The smallest unit of matter with unique...Ch. 2.L1 - 2. The charge of a proton is exactly balanced by...Ch. 2.L1 - Prob. 3MCQCh. 2.L1 - Prob. 4MCQCh. 2.L1 - Prob. 5MCQCh. 2.L1 - Prob. 6MCQCh. 2.L1 - Prob. 7MCQCh. 2.L1 - 8. An atom that can donate electrons during a...Ch. 2.L1 - 9. In a solution of NaCl and water, NaCl is the...Ch. 2.L1 - 10. A solution with a pH of 2 than a solution with...Ch. 2.L1 - 11. Fructose is a type of a. disaccharide b....Ch. 2.L1 - 6. Bonds in which atoms share electrons are...Ch. 2.L1 - 13. How is our understanding of microbiology...Ch. 2.L1 - 14. A phospholipid contains a. three fatty acids...Ch. 2.L1 - 15. Proteins are synthesized by linking amino...Ch. 2.L1 - 16. The amino acid that accounts for disulfide...Ch. 2.L1 - 17. DNA is a hereditary molecule that is composed...Ch. 2.L1 - 18. What is meant by the term DMA replication? a....Ch. 2.L1 - 19. Proteins can function as a. enzymes b....Ch. 2.L1 - 20. RNA plays an important role in what biological...Ch. 2.L1 - 1. Which of the following has not been a major...Ch. 2.L1 - 2. What was a significant result of the Mars...Ch. 2.L1 - Prob. 3CSRCh. 2.L1 - Prob. 1WCCh. 2.L1 - Prob. 2WCCh. 2.L1 - Prob. 3WCCh. 2.L1 - Prob. 4WCCh. 2.L1 - Prob. 5WCCh. 2.L1 - 6. Why are hydrogen bonds relatively weak?Ch. 2.L1 - 7. What kind of substances will be expected to be...Ch. 2.L1 - Prob. 8WCCh. 2.L1 - Prob. 9WCCh. 2.L1 - 10. What makes the amino acids distinctive, and...Ch. 2.L1 - Prob. 11WCCh. 2.L1 - Prob. 12WCCh. 2.L1 - 6. Bonds in which atoms share electrons are...Ch. 2.L2 - Prob. 1CTCh. 2.L2 - Prob. 2CTCh. 2.L2 - Prob. 3CTCh. 2.L2 - 4. Distinguish between polar and ionic compounds.Ch. 2.L2 - 5. Is galactose an aldehyde or a ketone sugar?Ch. 2.L2 - 6. a. How many water molecules are released when a...Ch. 2.L2 - Prob. 7CTCh. 2.L2 - Prob. 8CTCh. 2.L2 - Prob. 1VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax