Concepts of Genetics (11th Edition)
11th Edition
ISBN: 9780321948915
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 22, Problem 3NST
Summary Introduction
To determine: The sequence of the probe that will hybridize the ASO sequence.
Introduction: Allele-specific oligonucleotide (ASO) is a short synthetic DNA which is complementary to the sequence of target DNA. ASO analysis is done under conditions that facilitate only complementary
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Consider the structure of Cro repressor protein from bacteriophage lambda E. It is a DNA binding protein, and like many sequence-
specific DNA binding proteins, it must function as a homodimer Ex.
Notice the mutual docking of a phenylalanine residue from each subunit into a hydrophobic pocket of the partner subunit. These
hydrophobic interactions are required for dimerization.
The noncovalent interactions highlighted in yellow are also required for dimerization. These interactions represent examples of:
Osecondary structure
O tertiary structure
O quaternary structure
O secondary AND quaternary structure
Ⓒ tertiary AND quaternary structure
The haemoglobin proteins of RNA polymerase ii sub units
RPB1-P24928
RPB2-P30876
RPB3-P19387
RPB4-015514
are they similar? Explain?
The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant. The TATA box and kozak sequences are in parenthesis. What type of mutation is present?
Wild-type:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’
Mutant:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGC AGAGCATACTGAGGGTAGTAG-3’
Answer: Is this a transition mutation? because there is an exchange of G instead of A? It kind of confuses me a little. help
Chapter 22 Solutions
Concepts of Genetics (11th Edition)
Ch. 22 - In order to vaccinate people against diseases by...Ch. 22 - Prob. 2NSTCh. 22 - Prob. 3NSTCh. 22 - Prob. 1CSCh. 22 - Prob. 2CSCh. 22 - Prob. 3CSCh. 22 -
HOW DO WE KNOW?
In this chapter, we focused on a...Ch. 22 -
Review the Chapter Concepts list on page 569....Ch. 22 - Prob. 3PDQCh. 22 - Why are most recombinant human proteins produced...
Ch. 22 - Prob. 5PDQCh. 22 - One of the major causes of sickness, death, and...Ch. 22 - Describe how the team from the J. Craig Venter...Ch. 22 - Prob. 8PDQCh. 22 - Prob. 9PDQCh. 22 - Prob. 10PDQCh. 22 - As genetic testing becomes widespread, medical...Ch. 22 - Prob. 12PDQCh. 22 - Prob. 13PDQCh. 22 - What is the main purpose of genome-wide...Ch. 22 - Prob. 15PDQCh. 22 - Dominant mutations can be categorized according to...Ch. 22 - In 2013 the actress Angelina Jolie elected to have...Ch. 22 - Prob. 18PDQCh. 22 - Should the FDA regulate direct-to-consumer genetic...Ch. 22 - Prob. 20ESPCh. 22 - Following the tragic shooting of 20 children at a...Ch. 22 - Private companies are offering personal DNA...Ch. 22 - Prob. 23ESPCh. 22 - Prob. 24ESPCh. 22 - Prob. 25ESPCh. 22 - Prob. 26ESP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: 5’ ATG GCT AGA GTC GAG TTG 3’ Mutant 1: 5’ ATG GCA GAG TCG AGT TG 3’ Mutant 2: 5’ ATG GCT TGA GTC GAG TTG 3’ Mutant 3: 5’ ATG GCT AGA GTT GAG TTG 3’ Mutant 4: 5’ ATG GCT AGA AGT CGA GTT G 3’ Mutant 5: 5’ ATG GCT AGA ATC GAG GTT 3’arrow_forward. Explain why DNA is stable in the presence of alkali (0.3 M KOH), while RNA is quantitatively degraded to 2'- and 3'-nucleoside monophosphates under these conditions.arrow_forwardShown is part of the coding strand of the HBB gene involved in sickle cell disease. What will be the effect on the resulting peptide of a deletion of the two nucleotides shown in bold/underline? 5' CTG ACT CCT GAG GAC 3' a) A change from glutamic acid to valine will occur b) The deletion will not result in a change to the polypeptide c) A nonsense mutation will occur d) The polypeptide will be missing one amino acid, but the reading frame will be preservedarrow_forward
- Based on the sequence data in the figure above, would you consider the patient to be not affected, affected or a carrier? What type of mutation occurred in exon 13?arrow_forwardWhat type of mutation is shown below: CGG GGG GAG TCT TTT TAT GCA GCT changes to: CGG GGG GAG CTT TTTATG CAG CT A frame shift mutatuion which resulted from a deletion. O Point mutation in which one nucleotide was changed. O Point mutation in which a length of nucleotides were changed. O A frame shift mutatuion which resulted from an insertion.arrow_forwardA variety of organic chelating ligands have been synthesized to tightly coordinate radioactive metal cations to identify and treat malig- nancies by coupling the metal complex to a polypeptide linker attached to a monoclonal antibody that binds specifically to a cell surface re- ceptor. One such metal complex is illustrated in the diagram on the right. The radioactive Cu-64 cation is tightly coordinated by the che- lating ligand that is, in turn, conjugated to a peptide linker attached to a monoclonal antibody. (The antibody is not shown in this diagram.) When coupled to a specifically designed monoclonal antibody, the complex binds specifically to somatostatin receptors that are ex- pressed on the surface of neuroendocrine tumors. Subsequently the entire complex with the receptor is internalized, i.e., passed into the cytoplasm, where the radioactive metal cation kills the malignant cell. 1. CH3 HN NHNH HN NHNH HN Но НО NH HN S-S HN Но NH NH HN -NH HN- H2N OH NH ) Write the three…arrow_forward
- The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 20 ORI 40 60 5'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3' 3'...AAGCTCGAGAGCAGCAGCTСТАТGCGCTАСТАТААTGACСАТТАТАССССТАСGTGATAG...5" promoter a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 – 41 5' 3'arrow_forward5arrow_forwardThe beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 1 20 ORI 40 60 5'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3’ 3'...AAGCTCGAGAGCAGCAGCTСТАТGCGCTАСТАТААTGACCATTATАССССТАСGTGATAG...5' promoter 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 – 41 5' 3' 2b. Replication is occurring normally in these cells; would you expect to find a primer in both positions? Why or why not?arrow_forward
- Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the fragments generated with each treatment. Determine the original sequence for both fragmentations (reduerde that they must be equal in the order of amino acids) Quimotripsina 1. Leu-His-Lys-Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly-Pro-Ser 1. Gln-Gln-Ala-Gln-His-Leu-Arg-Ala-Cys-Gln-Gln-Trp 2. Arg-lle-Pro-Lys-Cys-Arg-Lys-Phe Trypsin 1. Arg 2. Ala-Cys-Gln-GIn-Trp-Leu-His-Lys 3. Cys-Arg 4. Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly- Pro-Ser 5. lle-Pro-Lys 6. Light 7. Phe-Gin-Gln-Ala-Gln-His-Leu-Argarrow_forwardA wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertionarrow_forwardWhat is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. provide calculationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY