Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 22, Problem 25RQ
MRSA has emerged as a serious infectious disease, with the first case of methicillin-resistant S. aureus being detected in 1961. Why are medical professionals so concerned when antibiotics exist that can kill MRSA?
- MRSA can transfer methicillin-resistance to other bacteria
- Patients are not treated with correct antibiotics rapidly enough to prevent serious illness
- MRSA could acquire additional antibiotic resistance genes from other bacteria to become a “super bug."
- All of the above.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 22 Solutions
Biology 2e
Ch. 22 - Figure 22.8 Compared to free-floating bacteria,...Ch. 22 - Figure 22.16 Which of the following statements is...Ch. 22 - Figure 22.19 Which of the following statements...Ch. 22 - The first forms of life on Earth were thought to...Ch. 22 - Microbial mats. are the earliest forms of life on...Ch. 22 - The first organisms that oxygenated the atmosphere...Ch. 22 - Halophiles are organisms that require a salt...Ch. 22 - Many of the first prokaryotes to be cultured in a...Ch. 22 - The presence of a membrane-enclosed nucleus is a...Ch. 22 - Which of the following consist of prokaryotic...
Ch. 22 - The cell wall is ___________ . interior to the...Ch. 22 - Organisms most likely to be found in extreme...Ch. 22 - Prokaryotes stain as Gram-positive or Gramnegative...Ch. 22 - Pseudopeptidoglycan is a characteristic of the...Ch. 22 - The lipopolysaccharide layer (LPS) is a...Ch. 22 - Which of the following elements is not a...Ch. 22 - Prokaryotes that obtain their energy from chemical...Ch. 22 - Ammonification is the process by which. ammonia is...Ch. 22 - Plants use carbon dioxide from the air and are...Ch. 22 - Cyanobacteria harness energy from the sun through...Ch. 22 - A disease that is constantly present in a...Ch. 22 - Which of the statements about biofilms is...Ch. 22 - Which of these statements is true? An antibiotic...Ch. 22 - A person in England arrives at a medical clinic...Ch. 22 - MRSA has emerged as a serious infectious disease,...Ch. 22 - Which of these occurs through symbiotic nitrogen...Ch. 22 - Synthetic compounds found in an organism but not...Ch. 22 - Bioremediation includes. the use of prokaryotes...Ch. 22 - In addition to providing yogurt with its unique...Ch. 22 - Describe briefly how you would detect the presence...Ch. 22 - Why do scientists believe that the first organisms...Ch. 22 - A new bacterial species is discovered and...Ch. 22 - Mention three differences between bacteria and...Ch. 22 - Explain the statement that both types, bacteria...Ch. 22 - A scientist isolates a new species of prokaryote...Ch. 22 - Think about the conditions (temperature, light,...Ch. 22 - Farmers continually rotate the crops grown in...Ch. 22 - Imagine a region of soil became contaminated,...Ch. 22 - Explain the reason why the imprudent and excessive...Ch. 22 - Researchers have discovered that washing spinach...Ch. 22 - Your friend believes that prokaryotes are always...Ch. 22 - Many people use antimicrobial soap to kill...
Additional Science Textbook Solutions
Find more solutions based on key concepts
3. CAUTION Why is genetic drift aptly named?
a. It causes allele frequencies to drift up or down randomly.
b. I...
Biological Science (6th Edition)
In the datura plant, purple flower color is controlled by a dominant allele P. White flowers are found in plant...
Genetic Analysis: An Integrated Approach (3rd Edition)
For the generic equilibrium HA(aq) ⇌ H + (aq) + A- (aq), which of these statements is true?
The equilibrium con...
Chemistry: The Central Science (14th Edition)
Police Captain Jeffers has suffered a myocardial infarction. a. Explain to his (nonmedically oriented) family w...
Human Physiology: An Integrated Approach (8th Edition)
What are the four types of tissues, and what are their characteristics?
Human Anatomy & Physiology (2nd Edition)
21. Two -diameter aluminum electrodes are spaced apart.
The electrodes are connected to a battery.
...
Physics for Scientists and Engineers: A Strategic Approach, Vol. 1 (Chs 1-21) (4th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Infectious Diseases - How do we control them?; Author: Let's Learn Public Health;https://www.youtube.com/watch?v=2JWku3Kjpq0;License: Standard Youtube License