
Microbiology: A Systems Approach
4th Edition
ISBN: 9780073402437
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 21.4, Problem 8AYP
Summary Introduction
To describe:
Symptoms appearing in each stage of whooping cough.
Concept introduction:
Whooping cough is called as pertussis. It is caused due to infection caused by bacteria Bordetella pertussis. Infection is caused due to formation of two stages in this disease called as catarrhal stage and paroxysmal stage.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 21 Solutions
Microbiology: A Systems Approach
Ch. 21.1 - Prob. 1AYPCh. 21.1 - Prob. 2AYPCh. 21.2 - Prob. 3AYPCh. 21.3 - Prob. 4AYPCh. 21.3 - Prob. 5AYPCh. 21.3 - Prob. 6AYPCh. 21.4 - Prob. 7AYPCh. 21.4 - Prob. 8AYPCh. 21.4 - Prob. 9AYPCh. 21.4 - Prob. 10AYP
Ch. 21.4 - Plan a response for a situation in which a patient...Ch. 21.4 - Compare and contrast antigenic drift and antigenic...Ch. 21.5 - Prob. 2CFCh. 21.5 - Prob. 13AYPCh. 21.5 - Prob. 14AYPCh. 21.5 - Prob. 15AYPCh. 21.5 - Prob. 16AYPCh. 21.5 - Prob. 17AYPCh. 21.5 - Prob. 18AYPCh. 21.5 - Prob. 19AYPCh. 21 - Prob. 1CFCh. 21 - Prob. 1MCQCh. 21 - Prob. 2MCQCh. 21 - Which is not a characteristic of Streptococcus...Ch. 21 - The common stain used to identify Mycobacterium...Ch. 21 - Prob. 5MCQCh. 21 - Prob. 6MCQCh. 21 - Which of the following infections often has a...Ch. 21 - Prob. 8MCQCh. 21 - Prob. 9MCQCh. 21 - Prob. 10MCQCh. 21 - Prob. 11TFCh. 21 - Prob. 12TFCh. 21 - Prob. 13TFCh. 21 - Prob. 14TFCh. 21 - Prob. 15TFCh. 21 - Prob. 1CTQCh. 21 - Prob. 2CTQCh. 21 - Prob. 3CTQCh. 21 - Prob. 4CTQCh. 21 - Prob. 5CTQCh. 21 - Prob. 6CTQCh. 21 - In an episode of the television show House. Dr....Ch. 21 - Prob. 8CTQCh. 21 - Prob. 9CTQCh. 21 - Prob. 10CTQCh. 21 - Prob. 1CCCh. 21 - Prob. 2CCCh. 21 - Prob. 3CCCh. 21 - Prob. 4CCCh. 21 - Prob. 1VCCh. 21 - Prob. 2VCCh. 21 - Prob. 1CM
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengageUnderstanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:Cengage

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage
Cancer Types SIMPLY explained! MEMORIZE them QUICKLY and EASILY!; Author: CancerEdInstitute;https://www.youtube.com/watch?v=dEBi-yvSWmQ;License: Standard Youtube License