
To determine:
The mode of transmission of tuberculosis in a population.
Introduction:
Tuberculosis is a potentially fatal disease caused by Mycobacterium tuberculosis which can infect almost every part of the body. It mainly infects the upper respiratory tract of the human body. The disease can be treated and cured with antibiotic and certain drugs.

Explanation of Solution
The bacterium Mycobacterium tuberculosis causes tuberculosis and lungs are primarily infected by this bacterium. The TB bacteria can invade other parts of the body apart from lungs, such as spine and kidney. Not every person exposed to TB bacteria gets the infection. There are two major medical conditions associated with TB bacteria, TB disease, and latent TB infection.
In a population, the infection of tuberculosis is transmitted by respiratory droplets which contain mucus and droplets are transferred from the infected person to others through coughing.
In a population, tuberculosis is transmitted through respiratory droplets from the infected person.
To determine:
The reason that homeless people are at risk for contracting tuberculosis
Introduction:
Tuberculosis is a potentially fatal disease caused by Mycobacterium tuberculosis which can infect almost every part of the body. It mainly infects the upper respiratory tract of the human body. The disease can be treated and cured with antibiotic and certain drugs.

Explanation of Solution
The reason that homeless people are at risk for contracting tuberculosis are given as follows:
1) Health care access is very limited to homeless people.
2) Misdiagnosis of tuberculosis with normal cold or pneumonia.
3) Homeless shelters are overcrowded which increases the transmission of disease through the respiratory droplet.
4) Tuberculosis is a bacterial disease which can be treated with antibiotics for several months, but the transient lifestyle of homeless people does not let them complete their antibiotics course.
Lack of healthcare facilities for the homeless people is the reason that they are more prone to tuberculosis.
Want to see more full solutions like this?
Chapter 21 Solutions
Microbiology: A Systems Approach
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





