
EBK CAMPBELL BIOLOGY IN FOCUS
2nd Edition
ISBN: 8220101459299
Author: Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 21.4, Problem 3CC
Summary Introduction
To determine:
The type of natural selection (directional, disruptive or stabilizing) in situation where heterozygotes for a certain locus in a population have extreme phenotype that confers a selective advantage.
Introduction:
Natural selection is processes by which organisms are tend to adapt the environment and produce more offsprings of particular traits. Natural selection: are of 3 types (a) stabilizing selection; in which an average phenotype is favored, (b) directional selection; in which the change in the environment change the wide range of
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Chapter 21 Solutions
EBK CAMPBELL BIOLOGY IN FOCUS
Ch. 21.1 - Explain why genetic variation within a population...Ch. 21.1 - Of all the mutations that occur in a population,...Ch. 21.1 - Prob. 3CCCh. 21.2 - A population has 700 individuals, 85 of genotype...Ch. 21.2 - The frequency of allele a is 0.45 for a population...Ch. 21.2 - WHAT IF? A locus that affects susceptibility to a...Ch. 21.3 - In what sense is natural selection more...Ch. 21.3 - Distinguish genetic drift from gene flow in terms...Ch. 21.3 - WHAT IF? Suppose two plant populations exchange...Ch. 21.4 - What is the relative fitness of a sterile mule?...
Ch. 21.4 - Explain why natural selection is the only...Ch. 21.4 - Prob. 3CCCh. 21 - Natural selection changes allele frequencies...Ch. 21 - No two people are genetically identical, except...Ch. 21 - Sparrows With average-sized w1ngs survive severe...Ch. 21 - If the nucleotide variability of a locus equals...Ch. 21 - There are 25 individuals in population 1, all with...Ch. 21 - A fruit fly population has a gene with two...Ch. 21 - FOCUS ON EVOLUTION Using at least TWO examples,...Ch. 21 - Prob. 9TYUCh. 21 - SYNTHESIZE YOUR KNOWLEDGE This kettle lake formed...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Developmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Mechanisms of Genetic Change or Evolution; Author: Scientist Cindy;https://www.youtube.com/watch?v=5FE8WvGzS4Q;License: Standard Youtube License